COMPOUND, COMPOSITION, COMBINATION, AND, PHARMACEUTICAL FORMULATION

专利摘要:
compound, composition, pharmaceutical formulation, methods for inhibiting an enzyme, for killing and/or preventing the growth of a microorganism, for treating and/or preventing a disease in an animal, and for inhibiting the editing domain of a synthetase of t-rna, e, use of a compound or a combination. the present invention relates to, among other items, benzoxaborol compounds and their use for the treatment of bacterial infections.
公开号:BR112013005426B1
申请号:R112013005426-3
申请日:2011-09-07
公开日:2021-08-24
发明作者:Vincent S. Hernandez；Charles DING；Jacob J. Plattner；Michael Richard Kevin Alley；Fernando Rock；Suoming Zhang；Eric Easom；Xianfeng Li；Ding Zhou
申请人:Anacor Pharmaceuticals, Inc；
IPC主号:

专利说明:

CROSS REFERENCES TO RELATED REQUEST
[001] This application claims the benefit of US Provisional Patent Application No. 61/380,596, filed September 7, 2010, which is incorporated by reference in its entirety for all purposes. FUNDAMENTALS OF THE INVENTION
[002] The global emergence of bacteria and other microorganisms resistant to antibiotics and antimicrobials in general pose a major threat. The deployment of massive amounts of antimicrobial agents into the ecosphere over the past 60 years has introduced powerful selective pressure for the emergence and spread of antimicrobial resistant pathogens. Thus, there is a need to discover new broad-spectrum antimicrobials, such as antibiotics, useful in combating microorganisms, especially those with multi-drug resistance.
[003] Boron-containing molecules such as 1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaborol (also known sometimes as 1-hydroxy-benzo[c][1,2]oxaborol or cyclic oxaborols or boronic esters), useful as antimicrobials have been previously described, such as in United States Patent Applications 12/142,692; 11/505,591 and 11/357,687. Generally speaking, a 1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaborol has the following structure and substituent numbering system:

[004] It has now been discovered that certain classes of 1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaboros are effective antibacterials. This, and other uses of these 1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaboros are described herein. SUMMARY OF THE INVENTION
[005] In a first aspect, the invention provides a compound having a structure according to the formula:
wherein R3 is substituted or unsubstituted nitroalkyl or substituted or unsubstituted aminoalkyl; R4 is selected from the group consisting of halogen, unsubstituted alkyl and unsubstituted phenyl; Y is O or S; R5 is selected from the group consisting of substituted or unsubstituted alkyl and substituted or unsubstituted heteroalkyl, or a salt, hydrate or solvent thereof.
[006] In a second aspect, the invention provides a combination comprising: a) a compound of the invention, or a pharmaceutically acceptable salt thereof; and b) a therapeutically active agent.
[007] In a third aspect, the invention provides a pharmaceutical formulation comprising: a) a compound of the invention, or a pharmaceutically acceptable salt thereof; and b) a pharmaceutically acceptable excipient.
[008] In a fourth aspect, the invention provides a method of eliminating or inhibiting the growth of a bacterium, said method comprising: contacting said bacterium with an effective amount of a compound of the invention or a combination of the invention, or a pharmaceutically acceptable salt in the same way, thereby eliminating or inhibiting the growth of the bacteria.
[009] In a fifth aspect, the invention provides a method of treating a bacterial infection comprising: administering to an animal suffering from said infection an effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection.
[0010] In a sixth aspect, the invention provides a method for inhibiting the editing domain of a t-RNA synthetase, comprising: contacting the synthetase with an effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, thereby inhibiting synthetase. BRIEF DESCRIPTION OF THE FIGURES
[0011] FIG. 1 shows biological data for exemplary compounds of the invention. DETAILED DESCRIPTION OF THE INVENTION I. Definitions and Abbreviations
[0012] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, reference to “an active agent” includes a single active agent as well as two or more different active agents in combination. It is to be understood that the present teaching is not limited to the specific dosage forms, carriers, or the like, disclosed herein and as such may vary.
[0013] The abbreviations used herein generally have their conventional meanings within chemical and biological techniques.
[0014] The following abbreviations have been used: Ac is acetyl; AcOH is acetic acid; ACTBr is cetyltrimethylammonium bromide; AIBN is azobisisobutyronitrile or 2.2 azobisisobutyronitrile; here it is aqueous; Air is aryl; B2pin2 is bis(pinacolato)diboron; Bn is generally benzyl [see Cbz for an exception example]; (BnS)2 is benzyl disulfide; BnSH is benzyl thiol or benzyl mercaptan; BnBr is benzyl bromide; Boc is tert-butoxy carbonyl; Boc2O is di-tert-butyl dicarbonate; Bz is generally benzoyl; BzOOH is benzoyl peroxide; Cbz or Z is benzyloxycarbonyl or carboxybenzyl; Cs2CO3 is cesium carbonate; CSA is camphor sulfonic acid; CTAB is cetyltrimethylammonium bromide; Cy is cyclohexyl; DABCO is 1,4-diazabicyclo[2.2.2]octane; DCM is dichloromethane or methylene chloride; DHP is dihydropyran; DIAD is diisopropyl azodicarboxylate; DIEA or DIPEA is N,N-diisopropylethylamine; DMAP is 4-(dimethylamino)pyridine; DME is 1,2-dimethoxyethane; DMF is N,N-dimethylformamide; DMSO is dimethylsulfoxide; equiv or eq. is equivalent; EtOAc is ethyl acetate; EtOH is ethanol; Et2O is diethyl ether; EDCI is N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride; ELS is evaporative light scattering; equiv or eq is equivalent; h is time; HATU is O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate; HOBt is N-hydroxybenzotriazole; HCl is hydrochloric acid; HPLC is high pressure liquid chromatography; ISCO Companion is automated flash chromatography equipment with UV absorption fraction analysis available from Presearch; KOAc or AcOK is potassium acetate; K2CO3 is potassium carbonate; LiAlH4 or LAH is lithium aluminum hydride; LDA is lithium diisopropylamide; LHMDS is lithium bis(trimethylsilyl) amide; KHMDS is potassium bis(trimethylsilyl) amide; LiOH is lithium hydroxide; m-CPBA is 3-chloroperoxybenzoic acid; MeCN or ACN is methyl cyanide or cyanomethane or ethanonitrile or acetonitrile which are all names for the same compound; MeOH is methanol; MgSO4 is magnesium sulfate; mins or min is minutes; Mp or MP is melting point; NaCNBH3 is sodium cyanoborohydride; NaOH is sodium hydroxide; Na2SO4 is sodium sulfate; NBS is N-bromosuccinimide; NH4Cl is ammonium chloride; NIS is N-iodosuccinimide; N2 is nitrogen; NMM is N-methylmorpholine; n-BuLi is n-butyllithium; overnight is O/N; PdCl2(pddf) is 1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium(II); Pd/C is the catalyst known as palladium on carbon; Pd2(dba)3 is an organometallic catalyst known as tris(dibenzylideneacetone) dipalladium (0); Ra Ni or Raney Ni is Raney nickel; Ph is phenyl; PMB is p-methoxybenzyl; PrOH is 1-propanol; iPrOH is 2-propanol; POCl3 is phosphorus chloride oxide; PTSA is para-toluene sulfonic acid; Pyr. or Pyr or Py as used herein means pyridine; RT or rt or r.t. is room temperature; sat. is saturated; Si-amine or Si-NH2 is amino functionalized silica, available from SiliCycle; Si-pyr is pyridyl functionalized silica, available from SiliCycle; TEA or Et3N is triethylamine; TFA is trifluoroacetic acid; Tf2O is trifluoromethanesulfonic anhydride; THF is tetrahydrofuran; TFAA is trifluoroacetic anhydride; THP is tetrahydropyranyl; TMSI is trimethylsilyl iodide; H2O is water; diNO2PhSO2Cl is dinitrophenyl sulfonyl chloride; 3-F-4-NO2-PhSO2Cl is 3-fluoro-4-nitrophenylsulfonyl chloride; 2-MeO-4-NO2-PhSO2Cl is 2-methoxy-4-nitrophenylsulfonyl chloride; and (EtO)2POCH2COOEt is a triethylester of phosphonoacetic acid known as triethyl phosphonoacetate.
"Compound of the invention" as used herein refers to the compounds discussed herein, salts (e.g., pharmaceutically acceptable salts), prodrugs, solvates and hydrates of such compounds.
[0016] The term "poly" as used herein means at least 2. For example, a polyvalent metal ion is a metal ion having a valence of at least 2.
[0017] [0001] "Fraction" refers to a radical of a molecule that is attached to the remainder of the molecule.
[0018] The symbol ^n/w', whether used as a bond or displayed perpendicular to a bond, indicates the point at which the displayed fraction is attached to the remainder of the molecule.
[0019] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and may include di- and multivalent radicals, having the number of carbon atoms designated (i.e. C1-C10 means one to ten carbons). In some embodiments, the term "alkyl" means a straight or branched chain, or combinations thereof, which may be fully saturated, mono or polyunsaturated, and may include di- and multivalent radicals. Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologues and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, noctyl, and others. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1 - and 3-propynyl, 3-butynyl, and the higher homologues and isomers.
The term "alkylene" alone or as part of another substituent means a divalent radical derived from an alkane, as exemplified by, but not limited to, -CH2CH2CH2CH2-. Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group generally having eight or fewer carbon atoms.
[0021] The term "alkenylene" by itself or as part of another substituent means a divalent radical derived from an alkene.
[0022] The term "cycloalkylene" alone or as part of another substituent means a divalent radical derived from a cycloalkyl.
[0023] The term "heteroalkylene" alone or as part of another substituent means a divalent radical derived from a heteroalkane.
[0024] The term "heterocycloalkylene" alone or as part of another substituent means a divalent radical derived from a heterocycloalkane.
[0025] The term "arylene" by itself or as part of another substituent means a divalent radical derived from an aryl.
[0026] The term "heteroarylene" by itself or as part of another substituent means a divalent radical derived from heteroaryl.
[0027] The terms "alkoxy", "alkylamino" and "alkylthio" (or thioalkoxy) are used in their conventional sense, and refer to those alkyl groups attached to the remainder of the molecule through an oxygen atom, an amino group , or a sulfur atom, respectively.
[0028] The term "heteroalkyl," alone or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of a set number of carbon atoms and at least one heteroatom. In some embodiments, the term "heteroalkyl", alone or in combination with another term, means a stable straight or branched chain, or combinations thereof, consisting of a stated number of carbon atoms and at least one heteroatom. In an exemplary embodiment, the heteroatoms can be selected from the group consisting of B, O, N and S, and wherein the nitrogen and sulfur atoms can optionally be oxidized and the nitrogen heteroatom can optionally be quaternized. The heteroatom(s) B, O, N and S can be placed at any interior position of the heteroalkyl group or at the position where the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2 -CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -CH2-CH=N-OCH3, and -CH=CH-N( CH3)-CH3. Up to two heteroatoms can be consecutive, such as, for example, -CH2-NH-OCH3. Similarly, the term "heteroalkylene" alone or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified but not limited by -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2- CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both ends of the chain (for example, alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and others). Still further, for alkylene and heteroalkylene linking groups, no linking group orientation is implied by the direction in which the linking group formula is written. For example, the formula -C(O)2R'- represents both -C(O)2R'- and -R'C(O)2-.
The terms "cycloalkyl" and "heterocycloalkyl", by themselves or in combination with other terms, represent, unless otherwise stated, cyclic versions of "alkyl" and "heteroalkyl", respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position where the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and others. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl , tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and others.
The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, an atom of fluorine, chlorine, bromine or iodine. Additionally, terms such as "haloalkyl," are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(C1-C4)alkyl" means to include, but not be limited to, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and others.
[0031] The term "aryl" means, unless otherwise stated, a polyunsaturated, aromatic substituent, which may be a single ring or multiple rings (preferably 1 or 2 or 3 rings), which are fused together or covalently connected. The term "heteroaryl" refers to aryl groups (or rings) that contain one to four heteroatoms. In an exemplary embodiment, the heteroatom is selected from B, N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2 -oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl , 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl , 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the aryl and heteroaryl ring systems noted above are selected from the group of acceptable substituents described below.
[0032] For brevity, the term "aryl" when used in combination with other terms (eg, aryloxy, arylthiooxy, arylalkyl) includes those radicals in which an aryl group is attached through the next moiety to the remainder of the molecule. Thus, the term "arylalkyl" is meant to include those radicals in which an aryl group is attached to an alkyl group (for example, benzyl, 1-(3-nitrophenyl)ethyl and others). A substituent such as benzyl or 1-(3-nitrophenyl)ethyl may also be represented by "substituted alkyl" in which the ethyl radical is substituted with a 3-nitrophenyl moiety. The term "aryloxy" means to include those radicals in which an aryl group is attached to an oxygen atom. The term "aryloxyalkyl" is meant to include those radicals in which an aryl group is attached to an oxygen atom which is then attached to an alkyl group (for example, phenoxymethyl, 3-(1-naphthyloxy)propyl, and others).
[0033] For brevity, the term "heteroaryl" when used in combination with other terms (eg, heteroaryloxy, heteroarylthiooxy, heteroarylalkyl) includes those radicals in which a heteroaryl group is attached via the next moiety to the remainder of the molecule. Thus, the term "heteroarylalkyl" is meant to include those radicals in which a heteroaryl group is attached to an alkyl group (for example, pyridylmethyl and others). The term "heteroaryloxy" is meant to include those radicals in which a heteroaryl group is attached to an oxygen atom. The term "heteroaryloxyalkyl" is meant to include those radicals in which an aryl group is attached to an oxygen atom which is then attached to an alkyl group (eg, 2-pyridyloxymethyl and others).
[0034] Each of the above terms (for example, "alkyl," "heteroalkyl," "aryl" and "heteroaryl") is meant to include both substituted and unsubstituted forms of the indicated radical. Preferred substitutes for each type of radical are provided below.
Substituents for alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are generically referred to as "alkyl group substituents", and they may be one or more of a variety of groups selected from, but not limited to: -R', -OR', =O, =NR', =N- OR', -NR'R", -SR', -halogen , -SiR'R"R"', -OC(O)R', -C(O)R', -CO2R', -CONR'R", -OC(O)NR'R", -NR"C (O)R', -NR'-C(O)NR"R"', -NR"C(O)2R', -NR"'''-C(NR'R"R'")=NR" '', -NR"''-C(NR'R")=NR'", -S(O)R', -S(O)2R', -S(O)2NR'R", -NR" SO2R', -CN, -NO2, -N3, -CH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, in a number ranging from zero to (2m'+1), where m' is the total number of carbon atoms in such a radical. R', R", R"', R"'' and R"''' each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g., 1- or 1-substituted aryl 2 or 3 halogens, substituted or unsubstituted alkyl, alkoxy or thioalkoxy groups, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each of the R', R", R"', R"'' and R"''' groups when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, -NR’R" means to include, but not be limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" means to include groups including carbon atoms bonded to groups other than hydrogen groups, such as haloalkyl (eg, -CF3 and -CH2CF3) and acyl (for example, -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, and others).
[0036] Similar to the substituents described for the alkyl radical, substituents for aryl and heteroaryl groups are generically referred to as "aryl group substituents". Substituents are selected from, for example: -R', -OR', =O, =NR', =N-OR', -NR'R", -SR', -halogen, - SiR'R"R" ', -OC(O)R', -C(O)R', -CO2R', -CONR'R", -OC(O)NR'R", - NR"C(O)R', -NR '-C(O)NR"R"', -NR"C(O)2R', -NR"'''-C(NR'R"R'")=NR"", -NR"''- C(NR'R")=NR'", -S(O)R', -S(O)2R', -S(O)2NR'R", -NR"SO2R', -CN, -NO2, -N3, -CH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R", R"', R"'' and R"''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl not replaced. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each of the R', R", R"', R"'' and R"''' groups when more than one of those groups is present.
Two of the substituents on adjacent aryl or heteroaryl ring atoms may be optionally substituted with a substituent of the formula -TC(O)-(CRR')qU-, wherein T and U are independently -NR-, -O- , -CRR'- or a single bond, eq is an integer from 0 to 3. Alternatively, two of the substituents on adjacent aryl or heteroaryl ring atoms may be optionally substituted with a substituent of the formula -A-(CH2)rB-, where A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'- or a bond single, er is an integer of 1 or 2 or 3 or 4. One of the single chains of the newly formed ring can now be optionally substituted by a double chain. Alternatively, two of the substituents on adjacent aryl or heteroaryl ring atoms may be optionally substituted by a substituent of the formula -(CRR')sX-(CR"R'")d-, where sed are independently integers from 0 or 1 or 2 or 3, and X is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or -S(O)2NR'-. The substituents R, R', R" and R'" are preferably independently selected from hydrogen or substituted or unsubstituted (C1 or C2 or C3 or C4 or C5 or C6)alkyl.
"Ring" as used herein means a substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. A ring includes fused ring fractions. The number of atom in a ring is usually defined by the number of members in the ring. For example, a “5 to 7 membered ring” means that there are 5 or 6 or 7 atoms in the surrounding array. Unless otherwise specified, the ring optionally includes a heteroatom. Thus, the term "5- to 7-membered ring" includes, for example, phenyl, pyridinyl and piperidinyl. The term "5- to 7-membered heterocycloalkyl ring", on the other hand, would include pyridinyl and piperidinyl, but not phenyl. The term "ring" further includes a ring system comprising more than one "ring", wherein each "ring" is independently defined as above.
[0039] As used herein, the term "heteroatom" includes atoms other than carbon (C) and hydrogen (H). Examples include oxygen (O), nitrogen (N), sulfur (S), silicon (Si), and boron (B).
[0040] The term "leaving group" means a functional group or atom that can be displaced by another functional group or atom in a substitution reaction, such as a nucleophilic substitution reaction. By way of example, representative leaving groups include triflate, chlorine, bromine and iodine groups; sulfonic ester groups such as mesylate, tosylate, brosylate, nosylate and others; and acyloxy groups such as acetoxy, trifluoroacetoxy and others.
[0041] The symbol "R" is a general abbreviation for a substituent group that is selected from substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl substituted and substituted or unsubstituted heterocycloalkyl.
[0042] By "effective" amount of a drug, formulation, or permeant is meant a sufficient amount of an active agent to provide the desired site or systemic effect. A "topically effective", "pharmaceutically effective", or "therapeutically effective" amount refers to the amount of drug needed to effect the desired result.
The term "pharmaceutically acceptable salt" is meant to include a salt of a compound of the invention that is prepared with relatively non-toxic acid or bases, depending on the particular substituents found in the compounds described herein. When compounds of the invention contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino (such as choline or diethylamine or amino acids such as d-arginine, l-arginine, d-lysine or l-lysine), or magnesium salt , or a similar salt. When compounds of the invention contain relatively basic functionality, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable addition salts include those derived from inorganic acids such as hydrochloric, hydrobromic, nitric, carbonic, monohydrogen carbon, phosphoric, monohydrogen phosphoric, dihydrogen phosphoric, sulfuric, monohydrogensulfuric, hydrodic, or phosphorous acids and others, as well as salts derived from organic acids relatively non-toxic acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, methanesulfonic, and other types. Also included are salts of amino acids such as arginate and others, and salts of organic acids such as glucuronic or galacturonic acids and others (see, for example, Berge et al., "Pharmaceutical Salts", Journal of Pharmaceutical Science 66: 1-19 ( 1977)). Certain specific compounds of the invention contain both basic and acidic functionalities which allow the compounds to be converted into either base or acid addition salts.
[0044] Neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compounds in conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubilities in polar solvents.
[0045] In addition to the salt forms, the invention provides compounds that are in a pro-drug form. Prodrugs of the compounds described herein readily undergo chemical changes under physiological conditions to provide the compounds of the invention. Additionally, prodrugs can be converted to the compounds of the invention by chemical or biochemical methods in an ex vivo environment.
Certain compounds of the invention may exist in insolvated forms as well as solvated forms, including hydrated forms. In general, solvated forms are equivalent to insolvated forms and are encompassed within the scope of the invention. Certain compounds of the invention can exist in multiple crystalline or amorphous forms.
[0047] Certain compounds of the invention possess asymmetric carbon atoms (optical centers) or double bonds; racemates, diastereomers, geometric isomers and individual isomers are encompassed within the scope of the invention. The graphical representations of racemic, ambiscalemic, and scalemic or enantiomerically pure compounds used here are taken from Maehr, J. Chem. Ed. 1985, 62: 114-120. Solid, broken wedges are used to denote the absolute configuration of a stereocenter unless otherwise noted. When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless otherwise specified, the compounds are intended to include both E and Z geometric isomers. Likewise, all tautomeric forms are included.
[0048] Compounds of the invention may exist in particular geometric or stereoisomeric forms. The invention contemplates all such compounds, including cis- and trans-isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers , racemic mixtures thereof, and other mixtures thereof, such as enantiomerically or diastereomerically enriched mixtures, as falling within the scope of the invention. Additional asymmetric carbon atoms can be present in a substituent such as an alkyl group. All of such isomers, as well as mixtures thereof, are intended to be included in this invention.
[0049] Optically active (R)- and (S)-isomers and d and l isomers can be prepared using chiral synthesizers or chiral reagents, or resolved to use conventional techniques. If, for example, a particular enantiomer of a compound of the invention is desired, it can be prepared by asymmetric synthesis, or by derivation with a chiral auxiliary, where the diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomers. Alternatively, where the molecule contains a basic functional group, such as an amino group, or a functional acidic group, such as a carboxyl group, diastereomeric salts can be formed with an optically active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic medium known in the art, and subsequent recovery of the pure enantiomers. Furthermore, separation of enantiomers and diastereomers is often carried out using chromatography employing chiral stationary phases, optionally in combination with chemical derivatization (eg formation of carbamates from amines).
[0050] The compounds of the invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds can be radiolabelled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I) or carbon-14 (14C). All isotopic variations of the compounds of the invention, whether radioactive or not, are intended to be encompassed within the scope of the invention.
[0051] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable carrier" refers to any formulation or carrier medium that provides for the proper delivery of an effective amount of an active agent as defined herein, does not interfere with the effectiveness of biological activity of the active agent, and which is sufficiently non-toxic to the host or patient. Representative carriers include water, oils, both vegetable and mineral, cream bases, lotion bases, ointment bases and others. Such bases include suspending agents, thickeners, penetration enhancers, and others. Their formulations are well known to those in the art of topical cosmetics and pharmaceuticals. Additional information regarding carriers can be found in Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams & Wilkins (2005) which is incorporated herein by reference.
[0052] The term "excipients" is conventionally known to mean carriers, diluents and/or vehicles used in formulating effective drug compositions for the intended use.
The term "microbial infection" or "infection by a microorganism" refers to any infection of host tissue by an infectious agent including, but not limited to, bacteria or protozoa (see, for example, Harrison's Principles of Internal Medicine , pp. 93-98 (Wilson et al., eds., 12th ed. 1991); Williams et al., J. of Medicinal Chem. 42:1481-1485 (1999), each incorporated herein by reference in its entirety).
[0054] "Biological medium" as used herein refers to both in vitro and in vivo biological media. Exemplary in vitro "biological media" include, but are not limited to, cell culture, tissue culture, homogenates, plasma and blood. In vivo applications are generally carried out in mammals, preferably humans.
[0055] "Inhibition" and "blockage" are used interchangeably here to refer to partial or complete blocking of the enzyme. In an exemplary embodiment, the enzyme is an editing domain of a tRNA synthetase.
[0056] Boron is capable of forming additional covalent or dative bonds with oxygen, sulfur or nitrogen under some circumstances in this invention.
[0057] Embodiments of the invention also encompass compounds that are poly or multivalent species, including, for example, species such as dimers, trimers, tetramers and higher homologs of the compounds of use in the invention or their reactive analogues.
[0058] "Salt counterion" as used herein refers to those positively charged ions that associate with a compound of the invention when boron is fully negatively or partially negatively charged. Examples of salt counterions include H+, H3O+, ammonium, potassium, calcium, magnesium (such as choline or diethylamine or amino acids such as d-arginine, l-arginine, d-lysine or l-lysine) and sodium.
[0059] Compounds comprising boron bonded to one carbon and three heteroatoms (such as three oxygens described in this section) may optionally contain either fully negatively charged boron or partially negatively charged boron. Due to the negative charge, a positively charged counterion can associate with this compound, thus forming a salt. Examples of salt counter ions include H+, H3O+, ammonium, potassium, calcium, magnesium (such as choline or diethylamine or amino acids such as d-arginine, l-arginine, d-lysine or l-lysine) and sodium. Salts of the compounds are implicitly contained in the descriptions of those compounds. II. Introduction
[0060] The invention provides novel boron compounds and methods for preparing these molecules. The invention further provides methods of treating bacterial infections, eliminating or inhibiting the growth of bacteria in part or entirely through the use of the compounds described herein. In another aspect, the invention is a combination of a compound of the invention and an antibiotic. In another aspect, the invention is a pharmaceutical formulation comprising a pharmaceutically acceptable excipient and a compound of the invention. In another aspect, the invention is a pharmaceutical formulation comprising a compound of the invention, an antibiotic, and a pharmaceutically acceptable excipient. III. Composition of Matter IV. . a.) Compounds
[0061] In one aspect the invention provides a compound of the invention. In an exemplary embodiment, the invention provides a compound described herein, or a salt thereof. In an exemplary embodiment, the salt of a compound described herein is a pharmaceutically acceptable salt. In an exemplary embodiment, the invention provides a compound described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the invention provides a compound described in a formula provided herein. In an exemplary embodiment, the invention provides a compound described herein.
[0062] In one aspect, the invention provides a compound having a structure that is:
wherein R3 is substituted or unsubstituted nitroalkyl or substituted or unsubstituted aminoalkyl; R4 is selected from the group consisting of halogen, unsubstituted alkyl, unsubstituted alkoxy and unsubstituted phenyl; Y is O or S; R5 is selected from the group consisting of substituted or unsubstituted alkyl and substituted or unsubstituted heteroalkyl; or a salt, hydrate or solvent thereof.
[0063] In one aspect, the invention provides a compound having a structure that is:
wherein R3 is substituted or unsubstituted nitroalkyl or substituted or unsubstituted aminoalkyl; R4 is selected from the group consisting of halogen, unsubstituted alkyl, unsubstituted alkoxy, and unsubstituted phenyl; Y is O or S; R5 is selected from the group consisting of substituted or unsubstituted alkyl and substituted or unsubstituted heteroalkyl; or a salt, hydrate or solvent thereof.
[0064] In one aspect, the invention provides a compound having a structure that is:
wherein R3 is substituted or unsubstituted nitroalkyl or substituted or unsubstituted aminoalkyl; R4 is selected from the group consisting of halogen, unsubstituted alkyl, unsubstituted alkoxy, and unsubstituted phenyl; Y is O or S; R5 is selected from the group consisting of substituted or unsubstituted alkyl and substituted or unsubstituted heteroalkyl; or a salt, hydrate or solvent thereof.
[0065] In an exemplary embodiment, a compound is provided having a structure in accordance with the following formula:
where C* is a carbon atom stereocenter that has a configuration that is (R) or (S). In an exemplary embodiment, the C* stereocenter is in the (S) configuration.
[0066] In an exemplary embodiment, a compound having a structure according to the following formula is provided:
where C* is a carbon atom stereocenter that has a configuration that is (R) or (S). In an exemplary embodiment, the C* stereocenter is in the (S) configuration.
[0067] In an exemplary embodiment, a compound having a structure according to the following formula is provided:
where C* is a carbon atom stereocenter that has a configuration that is (R) or (S). In an exemplary embodiment, the C* stereocenter is in the (S) configuration.
[0068] In an exemplary embodiment, Y, R5 and R4 are as described herein, R3 is -(CR20R21)nNR22R23 wherein n is an integer selected from 1 to 10; each R20 and each R21 is independently selected from the group consisting of H26 26 26 27 26 26 26 26 27 27 , R ,OR , NR R , SR , -S(O)R , -S(O)2R , -S(O )2NRR, -C(O)R, -C(O)OR27, -C(O)NR26R27; R22 and R23 are independently selected from the group consisting of H, -S(O)R28, -S(O)2R28, -S(O)2NR28R29, -C(O)R28, -C(O)OR28, -C( O)NR28R29, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, where each R26, each R27, each R28 and each R29 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0069] In an exemplary embodiment, Y, R5 and R4 are as described herein, and R3 is -CH2NH2 or -CH2NO2. In an exemplary embodiment, Y, R5 and R4 are as described herein, and R3 is -CH2NH2. In an exemplary embodiment, Y, R5 and R4 are as described herein, R3 is -CH2NH2, and C* has a configuration that is (S).
[0070] In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and sec-butyl. In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is selected from the group consisting of fluorine, chlorine, bromine and iodine. In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is chlorine or bromine. In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is chlorine.
[0071] In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is selected from the group consisting of methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy and sec-butoxy. In an exemplary embodiment, Y, R5 and R3 are as described herein, and R4 is methoxy or ethoxy. In an exemplary embodiment, Y, R5 and R3 are as described herein and R4 is methoxy.
[0072] In an exemplary embodiment, Y, R4 and R3 are as described here, and R5 is:
wherein a is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; each R10 and each R11 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, OH and NH2; R12 is selected from the group consisting of H, R7 7 78 7 7 8 7 , halogen, cyano, amidino, OR , NR R , SR , -N(R )S(O)2R , -C(O)R , -C (O)OR7, -C(O)NR7R8 wherein each R7 and each R8 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl , substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. In an exemplary embodiment, Y, R4, R3, R10, R11, and R12 are as described herein, and a is 1, 2, 3, 4, or 5. In an exemplary embodiment, Y, R4, R3, R10, R11 , and R12 are as described herein, and a is 2, 3, or 4. In an exemplary embodiment, Y, R4, R3, R10, R11, and R12 are as described herein, and a is 3. In an exemplary embodiment, Y , R4, R3, a and R12 are as described herein, and each R10 and each R11 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, OH and NH2. In an exemplary embodiment, Y, R4, R3, a and R12 are as described herein, and each R10 and each R11 is H. In an exemplary embodiment, Y, R4, R3, R10, R11, and a are as described herein, and R12 is selected from the group consisting of H, OH, NH2, methyl, ethyl, -NHS(O)2CH3, cyano, -NHC(O)CH3, -NHC(O)NHCH2CH3, -C(O)NH2, -C( O)OH, 4-(methoxy)phenyl, benzyl, benzoxy, -NHC(O)OCH2Ph, -C(O)NHCH2CH2OH and -C(NH2)(NH).
[0073] In an exemplary embodiment, R4, R3 and R5 are as described herein, and Y is O. In an exemplary embodiment, R4, R3 and Y are as described herein, and R5 is unsubstituted alkyl. In an exemplary embodiment, R4, R3 and Y are as described herein, and R5 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl and sec-butyl.
[0074] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl and sec-butyl. In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0075] In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is chloro, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0076] In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0077] In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0078] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is methyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is methyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is methyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is methyl.
[0079] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is ethyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is ethyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is ethyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is ethyl.
[0080] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is propyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is propyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is propyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is propyl.
[0081] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is isopropyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is isopropyl. In an exemplary embodiment, R4 is chloro, R3 is -CH2NH2; Y is O; and R5 is isopropyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is isopropyl.
[0082] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C4 alkyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C4 alkyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C4 alkyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C4 alkyl.
[0083] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C5 alkyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C5 alkyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C5 alkyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C5 alkyl.
[0084] In an exemplary embodiment, R4 is halogen, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C6 alkyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C6 alkyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C6 alkyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is unsubstituted C6 alkyl.
[0085] In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is chlorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0086] In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is fluorine, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0087] In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of methyl, ethyl, propyl and isopropyl. In an exemplary embodiment, R4 is bromo, R3 is -CH2NH2; Y is O; and R5 is selected from the group consisting of butyl, isobutyl, t-butyl and sec-butyl.
[0088] In an exemplary embodiment, R4 is as described herein, R3 is -CH2NH2; Y is O; and R5 is substituted or unsubstituted alkyl. In an exemplary embodiment, Y and R5 are as described herein, R3 is -CH2NH2; and R4 is halogen. In an exemplary embodiment, Y is as described herein, R4 is halogen; Y is O; and R5 is unsubstituted alkyl. In an exemplary embodiment, R3 is -CH2NH2; R4 is chlorine; Y is O; and R5 is substituted or unsubstituted alkyl. In an exemplary embodiment, R4 is as described herein, R3 is -CH2NH2; Y is O; and R5 is ethyl.
[0089] In an exemplary embodiment, the compound has a structure that is

[0090] In an exemplary embodiment, the compound has a structure that is
where R4, Y and R5 are as described herein.
[0091] [0002] In an exemplary embodiment, the compound has a structure that is
where R4, Y and R5 are as described herein.
[0092] In an exemplary embodiment, Y is O, and R4 and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is unsubstituted alkyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is methyl or ethyl or propyl or isopropyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is butyl or isobutyl or neobutyl or t-butyl.
[0093] In an exemplary embodiment, the compound has a structure that is
where R4, Y and R5 are as described herein.
[0094] In an exemplary embodiment, the compound has a structure that is
, where R4, and R5 are as described herein.
[0095] In an exemplary embodiment, Y is O, and R4 and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is unsubstituted alkyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is methyl or ethyl or propyl or isopropyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is butyl or isobutyl or neobutyl or t-butyl.
[0096] In an exemplary embodiment, the compound has a structure that is
, wherein R4, Y and R5 are as described herein.
em que R4, Y and R5 são como descritos aqui.[0097] In an exemplary embodiment, the compound has a structure that is where R4, Y and R5 are as described herein.
[0098] In an exemplary embodiment, Y is O, and R4 and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 are as described herein. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is unsubstituted alkyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is methyl or ethyl or propyl or isopropyl. In an exemplary embodiment, Y is O, R4 is halogen, and R5 is butyl or isobutyl or neobutyl or t-butyl.
[0099] In an exemplary embodiment, said alkyl is linear alkyl or branched alkyl. In an exemplary embodiment, said heteroalkyl is linear heteroalkyl or branched heteroalkyl.
[00100] In an exemplary embodiment, the invention provides poly or multivalent species of the compounds of the invention, including a dimer or a trimer. Another exemplary embodiment of the invention provides an anhydride of the compounds of the invention. In another exemplary embodiment, the invention provides poly or multivalent species of the compounds of the invention. In an exemplary embodiment, the invention provides a dimer of the compounds described herein. In an exemplary embodiment, the invention provides a dimer of the described compounds.
[00101] In an exemplary embodiment, the invention provides an anhydride of the compounds described herein. In an exemplary embodiment, the invention provides an anhydride of the compounds described herein.
[00102] In an exemplary embodiment, the invention provides a trimer of the compounds described herein. In an exemplary embodiment, the invention provides a trimer of the compounds described herein.
The compounds of the invention can form a hydrate with water, solvates with alcohols such as methanol, ethanol, propanol and others; adducts with amino compounds, such as ammonia, methylamine, ethylamine and others; adducts with acids such as formic acid, acetic acid and others; complexes with ethanolamine, quinoline, amino acids and others.
[00104] In an exemplary embodiment, the invention provides a compound described herein, or a salt, hydrate or solvent thereof, or a combination thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt, hydrate or solvent thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt thereof. In an exemplary embodiment, the salt is a pharmaceutically acceptable salt. In an exemplary embodiment, the invention provides a compound described herein, or a hydrate thereof. In an exemplary embodiment, the invention provides a compound described herein, or a solvate thereof. In an exemplary embodiment, the invention provides a compound described herein, or a prodrug thereof. In an exemplary embodiment, the invention provides a salt of a compound described herein. In an exemplary embodiment, the invention provides a pharmaceutically acceptable salt of a compound described herein. In an exemplary embodiment, the invention provides a hydrate of a compound described herein. In an exemplary embodiment, the invention provides a solvate of a compound described herein. In an exemplary embodiment, the invention provides a prodrug of a compound described herein. In an exemplary embodiment, the invention provides a compound as described in FIG. 1, or a salt thereof. In an exemplary embodiment, the invention provides a compound as described in FIG. 1, or a pharmaceutically acceptable salt thereof.
[00105] In an exemplary embodiment, alkyl is linear alkyl. In another exemplary embodiment, alkyl is branched alkyl.
[00106] In an exemplary embodiment, heteroalkyl is linear heteroalkyl. In another exemplary embodiment, heteroalkyl is branched heteroalkyl. III. b) Combinations comprising additional therapeutic agents
The compounds of the invention can also be used in combination with additional therapeutic agents. The invention thus provides, in a further aspect, a combination comprising a compound of the invention together with at least one additional therapeutic agent, or a salt, prodrug, hydrate or solvent thereof. In an exemplary embodiment, the compound of the invention is a compound described herein, or a salt thereof. In an exemplary embodiment, the additional therapeutic agent is a compound of the invention. In an exemplary embodiment, the additional therapeutic agent includes a boron atom. In an exemplary embodiment, the additional therapeutic agent does not contain a boron atom. In an exemplary embodiment, the additional therapeutic agent is a compound described in sections III a) or b).
[00108] When a compound of the invention is used in combination with a second therapeutic agent active against the same disease state, the dose of each compound may differ from that when the compound is used alone. Appropriate doses will be readily appreciated by those skilled in the art. It will be appreciated that the amount of a compound of the invention required for use in the treatment will vary with the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attending physician or veterinarian.
[00109] In an exemplary embodiment, the additional therapeutic agent is an antibacterial agent. In an exemplary embodiment, the additional therapeutic agent is an anti-tuberculosis agent. In an exemplary embodiment, the additional therapeutic agent is rifampicin. In an exemplary embodiment, the additional therapeutic agent is isoniazid. In an exemplary embodiment, the additional therapeutic agent is pyrazinamide. In an exemplary embodiment, the additional therapeutic agent is ethambutol. In an exemplary embodiment, the additional therapeutic agent is isoniazid. In an exemplary embodiment, the additional therapeutic agent is streptomycin. In an exemplary embodiment, the additional therapeutic agent is an aminoglycoside. In an exemplary embodiment, the additional therapeutic agent is amikacin or kanamycin. In an exemplary embodiment, the additional therapeutic agent is a polypeptide. In an exemplary embodiment, the additional therapeutic agent is selected from the group consisting of capreomycin, viomycin, and envioromycin. In an exemplary embodiment, the additional therapeutic agent is a fluoroquinolone. In an exemplary embodiment, the additional therapeutic agent is selected from the group consisting of ciprofloxacin, levofloxacin and moxifloxacin. In an exemplary embodiment, the additional therapeutic agent is a thioamide. In an exemplary embodiment, the additional therapeutic agent is ethionamide or prothionamide. In an exemplary embodiment, the additional therapeutic agent is cycloserine. In an exemplary embodiment, the additional therapeutic agent is p-aminosalicylic acid. In an exemplary embodiment, the additional therapeutic agent is selected from the group consisting of rifabutin, linezolid, thioacetazone, thioridazine, arginine, vitamin D, and R207910. In an exemplary embodiment, the additional therapeutic agent is a macrolide.
The individual components of such combinations may be administered either simultaneously or sequentially in unit dosage form. The unit dosage form can be a single unit dosage or multiple unit dosage forms. In an exemplary embodiment, the invention provides a combination in a single unit dosage form. An example of a single unit dosage is a capsule in which both the compound of the invention and the additional therapeutic agent are contained within the same capsule. In an exemplary embodiment, the invention provides a combination in a dual unit dosage form. An example of a dual unit dosage form is a first capsule containing the compound of the invention and a second capsule containing the additional therapeutic agent. So the term "single unit" or "double unit" or "multiple unit" refers to the object that the animal (eg, a human) ingests, not the interior components of the object. Appropriate doses of known therapeutic agents will be readily appreciated by those skilled in the art.
[00111] The combinations referred to herein can be conveniently presented for use in the form of a pharmaceutical formulation. Thus, an exemplary embodiment of the invention is a pharmaceutical formulation comprising a) a compound of the invention; b) an additional therapeutic agent and c) a pharmaceutically acceptable excipient. In an exemplary embodiment, the pharmaceutical formulation is in unit dosage form. In an exemplary embodiment, the pharmaceutical formulation is a single unit dosage form. In an exemplary embodiment, the pharmaceutical formulation is a single unit dosage form that includes a compound of the invention; an antibiotic and a pharmaceutically acceptable excipient. In an exemplary embodiment, the pharmaceutical formulation is a single unit dosage form that includes a compound of the invention; an antibiotic and at least one pharmaceutically acceptable excipient. In an exemplary embodiment, the pharmaceutical formulation is a dual unit dosage form. In an exemplary embodiment, the pharmaceutical formulation is a dual unit dosage form comprising a first unit dosage form and a second unit dosage form, wherein the first unit dosage form includes a) a compound of the invention and b) a first excipient pharmaceutically acceptable; and the second unit dosage form includes c) an additional therapeutic agent and d) a second pharmaceutically acceptable excipient. In an exemplary embodiment, the pharmaceutical formulation is a dual unit dosage form comprising a first unit dosage form and a second unit dosage form, wherein the first unit dosage form includes a) a compound of the invention and b) a first excipient pharmaceutically acceptable; and the second unit dosage form includes c) an antibiotic and d) a second pharmaceutically acceptable excipient. III. c) Preparation of Boron-Containing Compounds
Compounds for use in the invention can be prepared using commercially available prime materials, known intermediates, or using the synthetic methods published in references described and incorporated by reference herein, such as U.S. Pat. Apps. 12/142,692 and U.S. Pat. Pubs. US20060234981, US20070155699 and US20070293457.
[00113] The following general procedures were used as indicated in the generation of the examples and can be applied, using the knowledge of one skilled in the art, to other suitable compounds to obtain additional analogues. General Reaction Scheme 1
[00114] Scheme 1 describes a synthesis for compounds (I), wherein R4 is fluorine or chlorine and Y and R5 are as described herein. The fluorine or chlorine compound of formula A, which may be prepared or may be commercially available from Sigma-Aldrich, is reacted with a strong base (such as n-BuLi, sec-BuLi, or t-BuLi, 2 equiv) followed by cooling with a formylating agent (such as large excess of DMF, dimethylformamide, formanilide, N-formylmorpholine) to give the compound of formula B. Treatment of compound B with a demethylating agent (usually BBr3, 2 equiv) in a solvent (dichloromethane, THF) gives the phenol of formula C. Compound C can be reacted with a corresponding bromide or mesylate (1-1.5 equiv) in the presence of a base (such as KOtBu, K2CO3, or Cs2CO3, 1.5-2 equiv) in an aprotic solvent such as DMF or DMSO to produce the compound of formula D. Compound D can be converted to triflate E by reaction with 1.2 equiv of trifluoromethanesulfonic anhydride and pyridine in dichloromethane. The conversion of triflate E to boronate F can be achieved by reaction with bis(pinacolate)diborane (2 equiv), KOAc (3 equiv) and catalytic amount of PdCl2(dppf) (4-8 mol%). Reaction of compound F with nitromethane (3 equiv) in the presence of sodium hydroxide (3 equiv) in water or THF results in the nitro compound of formula G. Compound G can be converted to the final product of formula H by Raney reduction -Ni (Raney Ni, 2 equiv w/w, 2.0 M NH3 in EtOH, absolute EtOH). General Reaction Scheme 2
[00115] Scheme 2 describes a synthesis for compounds of (I), wherein R4 is chloro, Y and R5 are as described herein. The phenol or thiophenol of formula I, which may be prepared or may be commercially available from Sigma-Aldrich, reacts with a solution of bromine and catalytic amount of steel powder in glacial acetic acid to give the substituted bromine compound of formula J. Alkylation of J can be achieved by reacting with a bromide in the presence of one such as potassium carbonate in solvents such as DMF or acetonitrile. Aldehyde K protection can be achieved by refluxing with ethylene glycol in toluene, in the presence of the catalytic amount of p-toluenesulfonic acid. Reaction of compound L with BuLi and triisopropyl borate, followed by treatment with hydrochloric acid yields M boronic acid. Reaction of compound M with nitromethane in the presence of sodium hydroxide results in the nitro compound of formula N. Treatment of N with 1 equivalent of sulfur chloride yields the substituted chlorine compound O. Raney-Ni reduction of compound O in MeOH results in the final product of formula P. General Reaction Scheme 3
Scheme 3 depicts a synthesis of the compounds of (I), wherein R4 is bromo, Y and R5 are as described herein. The compound of formula N, which can be prepared according to scheme 2, can be reduced to the amine of formula S, by hydrogenation in the presence of palladium hydroxide or Raney-Ni reduction as described above. The amine of formula S is reacted with an N-protecting reagent such as Boc anhydride in the presence of triethylamine-type base in dichloromethane to give the Boc-protected compound of formula T. Treatment of T with N-bromosuccinimide and catalytic amount of AIBN in acetonitrile results in the bromine substituted compound of formula U. Deprotection of compound U in the presence of acid such as HCl in dioxane will yield the final compound of formula U. General reaction scheme 4.
[00117] Scheme 4 describes a synthesis for compounds of (I), wherein R4 is an alkyl or aryl group, Y and R5 are as described herein. The compound of formula N, which can be prepared according to scheme 2, can be brominated with N-bromosuccinimide and catalytic amount of AIBN in a solvent such as acetonitrile to give the bromide of formula W. Stille Coupling of W with a an organotine compound such as tetramethylstannane or tributyl-phenyl-stannane in the presence of catalytic Pd(Ph3P)4 in DMF produces the compound of formula X. Compound X can be reduced to the final compound of formula Y by hydrogenation in the presence of palladium on carbon or Raney-Ni reduction as described above. Alternatively, Stille reaction of W with an organotin compound such as vinyltributyltin in the presence of catalytic amount of Pd(Ph3P)4 in DMF produces the compound of formula Z. After Raney-Ni reduction of compound Z, further hydrogenation in the presence of palladium on carbon as described above will yield the final compound of formula AB. General reaction scheme 5: chiral separation
[00118] Scheme 5 describes a method for separating compounds (I) into their enantiomeric isomers, wherein R4, Y and R5 are as described herein. The compound of formula AC, which can be prepared according to scheme 1 or scheme 2 or scheme 3 or scheme 4, can be converted to Boc-protected compound AD by reaction with an N-protecting reagent such as Boc anhydride. presence of triethylamine-type base in dichloromethane. Racemic compound AD can be resolved by chiral HPLC using a chiral column such as ChiralPak AD-H and SF CO2 / methanol as eluent. Two compounds collected are AE enantiomer and AF enantiomer. Analysis of the enantiomeric purity of each isomer can be achieved using a chiral column such as ChiralPak AD column. Boc-protected compounds AE and AF can be converted to the final chiral compounds AG and AH, by deprotection using acid such as HCl in dioxane. General Reaction Scheme 6: Chiral Separation
[00119] Scheme 6 describes an alternative method to separate chiral compounds AI into their enantiomeric isomers, where R4, Y and R5 are as described herein. The compound of formula AI can be prepared according to scheme 1 or scheme 2 or scheme 3 or scheme 4. Separation of two enantiomers was achieved by dissolving racemic material AI in a suitable solvent and applying to an appropriate chiral column and system. of eluent. The collected separate enantiomer samples were then concentrated and used in the next step without further purification. Using this technique, it is possible to achieve a range of enantiomeric excesses of the separate enantiomers. The nitro compound AJ and AK can be converted to the final chiral compounds AL and AM, respectively, by Raney-Ni reduction (Raney Ni, 2 equiv w/w, 2.0 M NH3 in EtOH, absolute EtOH). IV. Essay
Recognized techniques of genetics technique and molecular biology are of use to identify compounds that bind to and/or inhibit an enzyme, such as tRNA synthetase. Furthermore, these techniques are of use to distinguish whether a compound binds to and/or inhibits a particular domain for the enzyme. For example, for leucyl tRNA synthetase (LeuRS), these techniques can distinguish whether a compound binds to and/or inhibits the synthetic domain, the editing domain, or both the editing and synthetic domains. The Mycobacterium tuberculosis leuS gene was synthesized by Genscript (Piscataway, NJ) using optimized E. coli codons and protein was made using standard T7 RNA polymerase super expression protocols and standard purification protocols. IV. a) LeuRS
[00121] In an exemplary trial, activity of a representative compound against editing domain was confirmed. To identify the target of a novel boron-containing antibacterial compound, mutants in E.coli showing resistance to the compound were isolated. Characterization of mutants showed that they have a 32-256 fold increase in compound resistance over wild type. Mutants have been shown to be sensitive to various antibacterial agents with known modes of action, suggesting that the compound's target cellular target is distinct from that of other antibacterial agents. The leuS gene from the mutants was cloned onto a plasmid and their resistance was confirmed by MIC. The editing domain from these mutants were sequenced and the mutations were all located in the editing domain of that enzyme.
[00122] Assays to determine whether, and how much effectively, a particular compound binds to and/or inhibits the editing domain of a selected tRNA synthetase are also shown here, and additional assays are readily available to those skilled in the art. Briefly, in an exemplary assay, an improperly loaded tRNA and a tRNA synthetase that is capable of editing the improperly loaded tRNA are combined. The resulting mixture is contacted with the putative inhibitor and the degree of editing inhibition is observed.
[00123] Another trial uses genetics to show that a drug works through editing domain. In this assay, the compound is first tested against overexpressing copies of a cell line of the tRNA synthetase gene. The effect of the compound on an overexpressing strain is compared to a control strain to determine if the compound is active against synthetase. If the minimal inhibitory concentration (MIC) is 2-fold higher in the strain with extra copies of the synthetase gene than the MIC of the inhibitor against a wild-type cell, further genetic screening is conducted to determine if the elevated resistance is due to mutations in the editing domain. In this second screen, the control strain is challenged against a high concentration of inhibitor. Colonies surviving the challenge are isolated and DNA from these cells is isolated. The editing domain is extended using a proof-read PCR enzyme and the appropriate primers. The PCR product can be purified using standard procedure. The amplified sequence mutant DNA is compared to wild type. If the mutant DNA carries mutations in the editing domain, such results would suggest that the compound binds to the editing domain and affects the molecule's editing function through that domain.
Generally, the compounds to be tested are present in the assays in the ranges from about 1 pM to about 100 mM, preferably from about 1 pM to about 1 µM. Other compounds range from about 1 nM to about 100 nM, preferably from about 1 nM to about 1 µM.
[00125] The effects of test compounds upon enzyme function can be measured by any suitable physiological change. When functional consequences are determined using intact cells or animals, one can also measure a variety of effects such as transmitter release, hormone release, transcriptional changes for both known uncharacterized genetic markers, changes in cell metabolism such as cell growth or changes of pH, and changes in intracellular second messengers such as Ca2+, or cyclic nucleotides.
[00126] Using the assays shown herein and others readily available in the art, those skilled in the art will be able to readily and routinely determine other compounds and classes of compounds that operate to bind to and/or inhibit the editing domain of the synthetases of tRNA.
[00127] In another aspect, the invention provides a method for identifying a compound that binds to an editing domain of a tRNA synthetase comprising: a) contacting said editing domain with a test compound under conditions suitable for binding; and b) detecting binding of said test compound to said editing domain. In an exemplary embodiment, detecting binding of said compound comprises using at least one detectable element, isotope, or chemical label attached to said compound. In an exemplary embodiment, the element, isotope, or chemical marker is detected by a fluorescent, luminescent, radioactive, or absorption display. In an exemplary embodiment, contacting said test compound with said editing domain also includes further contacting said test compound and said editing domain with a selected member of AMP and a molecule with a terminal adenosine. In an exemplary embodiment, tRNA synthetase is derived from leucyl tRNA synthetase. In an exemplary embodiment, the tRNA synthetase is derived from a mutated tRNA synthetase, wherein said mutated tRNA synthetase comprises amino acid mutations in an editing domain. In another exemplary embodiment, wherein said editing domain of a tRNA synthetase comprises the amino acid sequence of a peptide sequence described herein.
[00128] In another aspect, the invention is a method for identifying a compound that binds to an editing domain of a tRNA synthetase, said assay comprising: a) contacting said editing domain of a tRNA synthetase with said compound under conditions suitable for binding said compound with said editing domain of a tRNA synthetase; b) comparing a biological activity of said editing domain of a tRNA synthetase by contacting said compound with said biological activity when not contacting said compound; and c) identifying said compound as binding to said editing domain of a tRNA synthetase if said biological activity of said editing domain of a tRNA synthetase is reduced when contacting said compound. In an exemplary embodiment, the biological activity is non-cognate amino acid hydrolysis. In another exemplary embodiment, hydrolysis of said non-cognate amino acid is detected through the use of one or more markers. In another exemplary embodiment, the labels include a radio label, a fluorescent label, an antibody, or a combination thereof. In another exemplary embodiment, such markers can be detected using spectroscopy. In another exemplary embodiment, said editing domain of a tRNA synthetase is derived from leucyl tRNA synthetase.
[00129] In another aspect, the invention provides a method for generating a tRNA molecule with a non-cognate amino acid comprising: a) creating or isolating a mutated tRNA synthetase with altered amino acid editing domains; and b) contacting a tRNA molecule with said mutated tRNA synthetase and a non-cognate amino acid. In another exemplary embodiment, the mutated tRNA synthetase contains one or more amino acid mutations in an editing domain. In another exemplary embodiment, the mutated tRNA synthetase is unable to bind with a compound of the invention. In another exemplary embodiment, the mutated tRNA synthetase is unable to bind with a compound described herein, or a pharmaceutically acceptable salt thereof. In another exemplary embodiment, the mutated tRNA synthetase is unable to bind with a compound in accordance with a formula described herein, or a pharmaceutically acceptable salt thereof.
[00130] In another aspect, the invention provides a composition comprising one or more tRNA molecules attached to non-cognate amino acids, wherein said tRNA molecules are synthesized using one or more mutated tRNA synthetases isolated from a microorganism or a cell lineage derived from a microorganism. In an exemplary modality, the microorganism is a bacterium. In an exemplary embodiment, wherein said mutated tRNA synthetases contain amino acid mutations in their editing domains. V. Amino acid and nucleotide sequences used in assays
[00131] Amino acid and nucleotide sequences of use in the invention are published in references described and incorporated by reference herein, such as U.S. Pat. Apps. 12/142,692 and U.S. Pat. Pubs. US20060234981, US20070155699 and US20070293457. The sequence for M. tuberculosis codon optimized gene Lei is as follows: CATATGACCGAAAGCCCGACCGCAGGTCCGGGTGGT GTGCCGCGTGCGGATGATGCAGATAGCGATGTGCCGCGTTATCGTT ATACCGCGGAACTGGCGGCGCGTCTGGAACGTACCTGGCAGGAAA ACTGGGCGCGTCTGGGCACCTTTAACGTGCCGAACCCGGTGGGTA GCCTGGCACCGCCGGATGGTGCAGCAGTGCCGGATGATAAACTGT TTGTGCAGGATATGTTTCCGTATCCGAGCGGCGAAGGCCTGCATGT GGGCCATCCGCTGGGCTATATTGCGACCGATGTGTATGCGCGTTAT TTTCGTATGGTGGGCCGTAACGTGCTGCATGCGCTGGGCTTTGATG CGTTTGGTCTGCCGGCGGAACAGTATGCGGTGCAGACCGGCACCC ATCCGCGTACCCGTACCGAAGCGAACGTGGTGAACTTTCGTCGTCA GCTGGGCCGTCTGGGCTTTGGCCATGATAGCCGTCGTAGCTTTAGC ACCACCGATGTGGATTTTTATCGTTGGACCCAGTGGATTTTTCTGC AGATTTATAACGCGTGGTTTGATACCACCGCGAACAAAGCGCGTC CGATTAGCGAACTGGTGGCGGAATTTGAAAGCGGTGCACGTTGCC TGGATGGTGGTCGTGATTGGGCAAAACTGACCGCAGGTGAACGTG CGGATGTGATTGATGAATATCGTCTGGTGTATCGTGCGGATAGCCT GGTGAACTGGTGCCCGGGTCTGGGTACCGTGCTGGCAAACGAAGA AGTGACCGCAGATGGCCGTAGCGATCGTGGCAACTTTCCGGTGTTT CGTAAACGTCTGCGTCAGTGGATGATGCGTATTACCGCGTATGCGG ATCGTCTGCTGGATGATCTGGATGTGCTGGATTGGCCGGAACAG GT GAAAACCATGCAGCGTAACTGGATTGGCCGTAGCACCGGCGCGGT GGCGCTGTTTAGCGCGCGTGCGGCGAGCGATGATGGCTTTGAAGT GGATATTGAAGTGTTTACCACCCGTCCGGATACCCTGTTTGGCGCG ACCTATCTGGTGCTGGCGCCGGAACATGATCTGGTGGATGAACTG GTGGCGGCAAGCTGGCCGGCAGGTGTGAACCCGCTGTGGACCTAT GGCGGTGGTACCCCGGGTGAAGCAATTGCAGCATATCGTCGTGCG ATTGCGGCGAAAAGCGATCTGGAACGTCAGGAAAGCCGTGAAAA AACCGGCGTGTTTCTGGGCAGCTATGCGATTAACCCGGCGAACGG CGAACCGGTGCCGATTTTTATTGCGGATTATGTGCTGGCGGGCTAT GGCACCGGCGCGATTATGGCGGTGCCGGGCCATGATCAGCGTGAT TGGGATTTTGCGCGTGCGTTTGGCCTGCCGATTGTGGAAGTGATTG CAGGTGGAAACATTAGCGAAAGCGCGTATACCGGCGATGGCATTC TGGTGAACAGCGATTATCTGAACGGCATGAGCGTGCCGGCAGCAA AACGTGCAATTGTGGATCGTCTGGAAAGCGCAGGTCGTGGTCGTG CACGTATTGAATTTAAACTGCGTGATTGGCTGTTTGCGCGTCAGCG TTATTGGGGCGAACCGTTTCCGATTGTGTATGATAGCGATGGCCGT CCGCATGCGCTGGATGAAGCGGCGCTGCCGGTGGAACTGCCGGAT GTGCCGGATTATAGCCCGGTGCTGTTTGATCCGGATGATGCGGATA GCGAACCGAGCCCGCCGCTGGCGAAAGCGACCGAATGGGTGCATG TGGATCTGGATCTGGGCGATGGCCTGAAACCGTATAGCCGTGATA CCAACGTGATGCCGCAGTGGGCGGGCAGCAGCTGGTATGAACTGC GTTATACCGATCCGCATAACAGCGAA CGTTTTTGCGCGAAAGAAA ACGAAGCGTATTGGATGGGTCCGCGTCCGGCAGAACATGGTCCGG ATGATCCGGGTGGTGTGGATCTGTATGTGGGCGGCGCGGAACATG CGGTGCTGCATCTGCTGTATAGCCGTTTTTGGCATAAAGTGCTGTA TGATCTGGGCCATGTGAGCAGCCGTGAACCGTATCGTCGTCTGGTG AACCAGGGCTATATTCAGGCGTATGCGTATACCGATGCGCGTGGC AGCTATGTGCCGGCGGAACAAGTGATTGAACGTGGCGATCGTTTT GTGTATCCGGGCCCGGATGGCGAAGTGGAAGTGTTTCAGGAATTT GGCAAAATTGGCAAAAGCCTGAAAAACAGCGTGAGCCCGGATGA AATTTGCGATGCGTATGGCGCGGATACCCTGCGTGTGTATGAAATG AGCATGGGCCCGCTGGAAGCGAGCCGTCCGTGGGCGACCAAAGAT GTGGTGGGCGCGTATCGTTTTCTGCAGCGTGTGTGGCGTCTGGTGG TGGATGAACATACCGGCGAAACCCGTGTGGCGGATGGCGTGGAAC TGGATATTGATACCCTGCGTGCGCTGCATCGTACCATTGTGGGCGT GAGCGAAGATTTTGCGGCGCTGCGTAACAACACCGCGACCGCGAA ACTGATTGAATATACCAACCATCTGACCAAAAAACATCGTGATGC AGTGCCGCGTGCGGCAGTGGAACCGCTGGTGCAGATGCTGGCACC GCTGGCACCGCATATTGCGGAAGAACTGTGGCTGCGTCTGGGCAA CACCACCAGCCTGGCGCATGGCCCGTTTCCGAAAGCGGATGCGGC GTATCTGGTGGATGAAACCGTGGAATATCCGGTGCAGGTGAACGG CAAAGTGCGTGGTCGTGTGGTGGTGGCGGCGGATACCGATGAAGA AACCCTGAAAGCGGCGGTGCTGACCGATGAAAAAGTGCAGGCGTT TCTGGCGGGC GCGACCCCGCGTAAAGTGATTGTGGTGGCGGGCCG TCTGGTGAACCTGGTGATTTAACTCGAG SAW. Methods
[00132] In another aspect, the compounds of the invention can be used to inhibit an enzyme. In another aspect, compounds of the invention and/or combinations of the invention exhibit potency against microorganisms, such as bacteria, and therefore have the potential to eliminate and/or inhibit the growth of microorganisms. In another aspect, compounds of the invention and/or combinations of the invention exhibit potency against microorganisms, such as bacteria, and therefore have the potential to achieve therapeutic efficacy in the animals described herein. VII. a) LeuRS
[00133] In an exemplary embodiment, the compounds of the invention exhibit the ability to inhibit the editing domain of tRNA synthetases, such as tRNA leucilla synthase, of microorganisms, such as bacteria, and therefore have the potential to be used as inhibitors from the editing domain of microorganism tRNA synthetases.
According to another aspect of the invention, a method for binding to and/or inhibiting the editing domain of a tRNA synthetase is provided which comprises contacting a tRNA synthetase with a compound of the invention that inhibits the editing domain under conditions wherein the tRNA synthetase interacts with its substrate to form an aminoacyl adenylate intermediate and, preferably, to form a charged tRNA. Such conditions are known to those skilled in the art. In an exemplary embodiment, the compound has a structure in accordance with a formula described herein. In an exemplary embodiment, the compound is described herein, or a salt, hydrate or solvent thereof, or a combination thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt, hydrate or solvent thereof. In an exemplary embodiment, the invention provides a compound described herein or a salt thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt thereof. The tRNA synthetase is contacted with an amount of the compound of the invention sufficient to result in a detectable amount of tRNA synthetase inhibition. These methods can be performed on a tRNA synthetase that is either contained within an organism or that is outside an organism. In an exemplary embodiment, the method is performed on a tRNA synthetase that is contained within a microorganism or a microbial cell that is on or on the surface of an animal. In an exemplary modality, the animal is a human. The method results in a decrease in the amount of charged tRNA produced by tRNA synthetase that has an inhibited editing domain. In an exemplary embodiment, inhibition occurs in a cell, such as a microorganism cell. In another exemplary embodiment, the microorganism cell is a bacterium. In another exemplary embodiment, the tRNA synthetase is leucyl tRNA synthetase.
[00135] In an exemplary embodiment, the invention provides a method of inhibiting the conversion of a tRNA molecule into a charged tRNA molecule. The method involves contacting a tRNA synthetase with a compound of the invention effective to inhibit activity of an editing domain of said tRNA synthetase, under conditions sufficient to inhibit said activity, thereby inhibiting said conversion. In an exemplary embodiment, the compound of the invention is a compound described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, inhibition occurs within a cell, and the cell is a microorganism cell. In another exemplary embodiment, the microorganism cell is a bacterium. In another exemplary embodiment, the microorganism cell is a bacterium that is described here. In another exemplary embodiment, the enzyme is a leucyl tRNA synthetase from a bacterium described herein. In another exemplary embodiment, the tRNA synthetase is leucyl tRNA synthetase. In another exemplary embodiment, the compound has a KD, synthesis of more than 100 µM against a synthetic domain of said tRNA synthetase.
In certain embodiments, the mechanism of action of a compound of the invention is to inhibit the conversion of a tRNA molecule into a charged tRNA molecule by binding it to and/or inhibiting at least the editing domain of the synthetase. Compounds for use in this method may also inhibit or otherwise interact with the synthetic domain (eg, the active site of the synthetic domain). In a presently preferred embodiment, the editing domain is selectively inhibited in the presence of the synthetic domain. In a preferred embodiment, the synthetic domain is essentially uninhibited, while the editing domain is inhibited by at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80% and even more preferably at least 90% of the tRNA synthetase activity. In another preferred embodiment, the synthetic domain is inhibited by at most 50%, preferably at most 30%, preferably at most 20%, 10%, preferably at most 8%, more preferably at most 5%, even more preferably at most 3 % and even more preferably at most 1%. Inhibition of the editing domain produces a decrease in the amount of properly loaded tRNA that results in the delay or cessation of cell growth and division.
[00137] In another exemplary embodiment, the ratio of a minimum concentration of said compound inhibiting said editing domain to a minimum concentration of said compound inhibiting said synthetic domain of said tRNA synthetase, represented as KD, edit/KD, synthesis, is less than one. In another exemplary embodiment, the KD, edit /KD, compound synthesis is a selected member of less than 0.5, less than 0.1, and less than 0.05. SAW. b) Inhibition of microorganism growth or elimination of microorganisms
The compounds of the invention and/or combinations of the invention exhibit potency against microorganisms, such as bacteria, and therefore have the potential to treat, and/or prevent a microorganism infection, or eliminate and/or inhibit the growth of microorganisms.
[00139] In a further aspect, the invention provides a method of treating and/or preventing a microorganism infection, or a method of eliminating and/or inhibiting the growth of a microorganism, said method comprising: contacting said microorganism with an amount of a compound of the invention, thereby eliminating and/or inhibiting the growth of the microorganism. In a further aspect, the invention provides a method of treating and/or preventing a microorganism infection, or a method of eliminating and/or inhibiting the growth of a microorganism, said method comprising: contacting said microorganism with an effective amount of the combination of the invention, thereby eliminating and/or inhibiting the growth of the microorganism.
[00140] In a further aspect, the invention provides a method of treating a bacterial infection comprising administering to an animal suffering from the infection an effective amount of a compound of the invention or a combination of the invention, or a pharmaceutically acceptable salt thereof, thereof. way treating the bacterial infection. In an exemplary embodiment, the invention provides a method of treating a bacterial infection comprising administering to an animal suffering from the infection an effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, and an effective amount of an antibiotic, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection.
[00141] In a further aspect, the invention provides a method of preventing a bacterial infection comprising administering to an animal a prophylactic amount of a compound of the invention or a combination of the invention, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection. In an exemplary embodiment, the invention provides a method of preventing a bacterial infection comprising administering to an animal a prophylactic amount of a compound of the invention, or a pharmaceutically acceptable salt thereof.
[00142] In an exemplary modality, the microorganism is a bacterium. In an exemplary embodiment, the compound or combination is described herein, or a salt, prodrug, hydrate or solvent thereof, or a combination thereof. In an exemplary embodiment, the invention provides a compound or combination described herein, or a salt, hydrate or solvent thereof. In an exemplary embodiment, the invention provides a compound or combination described herein, or a prodrug thereof. In an exemplary embodiment, the invention provides a compound or combination described herein, or a salt thereof. In another exemplary embodiment, the compound or combination of the invention is a compound or combination described herein, or a pharmaceutically acceptable salt thereof. In another exemplary embodiment, the compound or compound of the combination is described by the formula listed herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the compound is part of a combination described herein. In an exemplary embodiment, the compound is part of a pharmaceutical formulation described herein. In another exemplary modality, contact occurs under conditions that allow the compound to enter the body. Such conditions are known to one of skill in the art and are described here.
[00143] In another aspect, the microorganism is in or on the surface of an animal. In another exemplary embodiment, the animal is described here. In another exemplary modality, the animal is a human.
[00144] In an exemplary embodiment, the microorganism infection is treated and/or prevented, or the microorganism is eliminated or its growth is inhibited, through oral administration of the compound of the invention and/or the combination of the invention. In an exemplary embodiment, the microorganism infection is treated and/or prevented, or the microorganism is eliminated or its growth inhibited by intravenous administration of the compound of the invention and/or the combination of the invention.
[00145] In an exemplary modality, the microorganism is a bacterium. In an exemplary embodiment, an infection is caused by and/or associated with a microorganism, particularly a bacterium. In an exemplary embodiment, the bacterium is a gram-positive bacterium. In another exemplary modality, the gram-positive bacteria is selected from the group consisting of Staphylococcus species, Streptococcus species, Bacillus species, Mycobacterium species, Corynebacterium species (Propionibacterium species), Clostridium species, Actinomyces species, of Enterococcus and Streptomyces species. In another exemplary modality, the gram-positive bacteria is selected from the group consisting of Propionibacterium acnes, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Staphylococcus haemolyticus, Streptococcus pyogenes, Streptococcus faecoccus fagalactiae, Enterococcus pneumoniae, Enterelium pneumoniae anthracis, Corynebacterium diphtheria, Clostridium perfringens, Clostridium botulinum, Clostridium tetani and Clostridium difficile. In another exemplary modality, the gram-positive bacteria is selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus piogenes, Enterococcus faecalis, Enterococcus faecium, Clostridium difficile and Propionibacter acnes. In another exemplary embodiment, the bacterium is a gram-negative bacterium. In another exemplary modality, the gram-negative bacteria is selected from the group consisting of Acinetobacter species, Neisseria species, Pseudomonas species, Brucella species, Agrobacterium species, Bordetella species, Escherichia species, Shigelia species, Yersinia, Salmonella species, Klebsiella species, Enterobacter species, Haemophilus species, Pasteurella species, Streptobacillus species, spirochetal species, Campylobacter species, Vibrio species, Helicobacter species, Bacteroides species, Citrobacter species, Proteus species, Providencia species, Serratia species, Stenotrophomonas species and Burkholderia species. In another exemplary modality, the gram-negative bacteria is selected from the group consisting of Acinetobacter species, Pseudomonas species, Escherichia species, Klebsiella species, Enterobacter species, Bacteroides species, Citrobacter species, Proteus species, Providencia, Serratia species, Stenotrophomonas species and Burkholderia species. In another exemplary modality, the gram-negative bacterium is selected from the group consisting of Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Legionella pneumophila, Escherichia coli, Yersinia pestis, Haemophilus influenzae, Helicobacter pylori, Campylobacter, Vibrioje, Campylobacter febrioje, Campylo parahemolyticus Trepomena pallidum Rickettsia prowazekii Rickettsia rickettsii Chlamydia trachomatis Chlamydia psittaci Brucella abortus Stenotrophomonas maltophilia and Burkholderia cepacia. In another exemplary modality, the gram-negative bacterium is selected from the group consisting of Pseudomonas aeruginosa, Escherichia coli, Haemophilus influenzae, Klebsiella pneumoniae, Enterobacter cloacae, Acinetobacter baumannii, Bacteroides fragilis, Citrobacter freundii, Proteus mirabilisartii, Providencia marbilicesartii, Providencia marbilicesartii, Providence maltophilia and Burkholderia cepacia. In another exemplary modality, the gram-negative bacteria is selected from the group consisting of Enterobacter aerogenes, Enterobacter cloacae, Enterobacter sakazakii, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Serratia marcescens and Citrobacter freundii. In another exemplary modality, the gram-negative bacterium is a Providencia spp..
[00146] In an exemplary embodiment, the microorganism is an acid-fast bacteria. In another exemplary modality, the bacterium is a Mycobacterium spp.. In another exemplary modality, the bacterium is Mycobacterium avium. In another exemplary embodiment, the bacterium is Mycobacterium avium-intracellulare. In another exemplary modality, the bacterium is Mycobacterium kansasii. In another exemplary modality, the bacterium is Mycobacterium leprae. In another exemplary modality, the bacterium is Mycobacterium lepromatosis. In another exemplary modality, the bacterium is Mycobacterium africanum. In another exemplary modality, the bacterium is Mycobacterium canetti. In another exemplary modality, the bacterium is Mycobacterium microti. In another exemplary modality, the bacterium is Mycobacterium tuberculosis. In another exemplary modality, the bacterium is Mycobacterium tuberculosis, which is resistant to multiple drugs. In another exemplary modality, the bacterium is Mycobacterium tuberculosis which is extensively resistant to the drug. In another exemplary modality, the bacterium is Mycobacterium tuberculosis, which is resistant to rifampicin. In another exemplary modality, the bacterium is Mycobacterium tuberculosis, which is resistant to isoniazid. In another exemplary modality, the bacterium is Mycobacterium tuberculosis which is resistant to kanamycin. In another exemplary modality, the bacterium is Mycobacterium tuberculosis which is resistant to capreomycin. In another exemplary modality, the bacterium is Mycobacterium tuberculosis which is resistant to amikacin.
[00147] In another exemplary modality, the bacterium is Pseudomonas species. In another exemplary modality, the bacterium is Pseudomonas aeruginosa. In another exemplary modality, the bacterium is selected from the group consisting of Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia and Burkholderia cepacia. In another exemplary modality, the bacterium is Acinetobacter baumannii. In another exemplary modality, the bacterium is Stenotrophomonas maltophilia. In another exemplary modality, the bacterium is Burkholderia cepacia. In another exemplary modality, the bacterium is Acinetobacter species. In another exemplary modality, the bacterium is Acinetobacter anitratus. In another exemplary modality, the bacterium is selected from the group consisting of Enterobacter aerogenes, Enterobacter cloacae, Enterobacter sakazakii, E. coli, K. pneumoniae, P. mirabilis, Serratia marcescens, Citrobacter freundii and Providencia spp. In another exemplary modality, the bacterium is selected from the group consisting of Enterobacter aerogenes, Enterobacter cloacae, Enterobacter sakazakii, E. coli, K. pneumoniae, P. mirabilis, Serratia marcescens, Citrobacter freundii, Providencia spp., S. aureus, S. pneumonia, S. pyogenes, E. faecalis, and E. faecium. In another exemplary modality, the bacterium is selected from the group consisting of Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia, Burkholderia cepacia. In another exemplary modality, the bacterium is selected from the group consisting of S. aureus, S. pneumonia, S. pyogenes, E. faecalis, and E. faecium. In another exemplary modality, the bacterium is selected from the group constituted by Viridans group Strep. In another exemplary modality, the bacterium is selected from the group constituted by Strep. mitis, Strep. mutans, Strep. oralis, Strep. bloodthirs, Strep. sobrinus and Strep. millari. In another exemplary modality, the bacterium is S. pneumonia. In another exemplary modality, the bacterium is H. influenzae. In another exemplary modality, the bacterium is S. aureus. In another exemplary modality, the bacterium is M. catarrhalis. In another exemplary modality, the bacterium is M. pneumoniae. In another exemplary modality, the bacterium is L. pneumoniae. In another exemplary modality, the bacterium is C. pneumoniae. In another exemplary modality, the bacterium is S. pyogenes. In another exemplary modality, the bacterium is an anaerobe. In another exemplary modality, the bacterium is a species of Alcaligenes. In another exemplary modality, the bacterium is a B. cepacia. In another exemplary modality, the bacterium is selected from the group consisting of Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Providencia stuartii, Serratia marcescens, and Citrobacter freundii. In another exemplary modality, the bacterium is resistant to methicillin. In another exemplary modality, the bacterium is methicillin-resistant Staphylococcus aureus. In another exemplary modality, the bacterium is selected from the group consisting of Streptococcus pneumoniae, Haemophilus influenzae, Staphylococcus aureus, Mycobacterium catarrhalis, Mycobacterium pneumoniae, Legionella pneumophila and Chlamydia pneumoniae. In another exemplary modality, the bacterium is selected from the group consisting of Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Serratia marcescens, Citrobacter freundii, Providencia stuartii, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophiacoccus Streptomonas, Burkoccus maltoccus pneumoniae, Streptococcus pyogenes, Enterococcus faecalis, and Enterococcus faecium. In another exemplary modality, the bacterium is selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae.
[00148] In an exemplary modality, the microorganism is a bacterium, which is selected from the group consisting of bacillus, including Bacillus species, Corynebacterium species (also Propionibacterium) and Clostridium species; filamentous bacteria, including Actinomyces species and Streptomyces species; bacilli such as Pseudomonas species, Brucella species, Agrobacterium species, Bordetella species, Escherichia species, Shigella species, Yersinia species, Salmonella species, Klebsiella species, Enterobacter species, Haemophilus species, Haemophilus species Pasteurella and Streptobacillus species; spirochetal species, Campylobacter species, Vibrio species; and intracellular bacteria including Rickettsiae species and Chlamydia species. SAW. b) Microorganism infection
The compounds of the invention and/or combinations of the invention exhibit potency against microorganisms, such as bacteria, and therefore have the potential to be used to treat and/or prevent a microorganism infection, such as a bacterial infection.
[00150] In a further aspect, the invention provides a method of treating a bacterial infection comprising administering to an animal suffering from the infection an effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection. . In an exemplary embodiment, the invention provides a method of treating a bacterial infection comprising administering to an animal suffering from the infection an effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, and an effective amount of an antibiotic, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection.
In a further aspect, the invention provides a method of preventing a bacterial infection comprising administering to an animal a prophylactic amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, thereby treating the bacterial infection. In an exemplary embodiment, the invention provides a method of preventing a bacterial infection comprising administering to an animal a prophylactic amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, and an effective amount of an antibiotic, or a pharmaceutically acceptable salt likewise, thereby treating the bacterial infection. SAW. c) Diseases
The compounds of the invention and/or combinations of the invention exhibit potency against microorganisms, such as bacteria, and therefore have the potential to achieve therapeutic efficacy in the animals described herein.
[00153] In another aspect, the invention provides a method of treating and/or preventing a disease. In an exemplary embodiment, the method includes administering to the animal a therapeutically effective amount of a compound of the invention, thereby treating and/or preventing the disease. In an exemplary embodiment, the method includes administering to the animal a therapeutically effective amount of a combination of the invention, thereby treating and/or preventing the disease. In an exemplary embodiment, the compound of the invention or the combination of the invention may be used in human or veterinary medical therapy, particularly in the treatment or prophylaxis of disease associated with bacteria. In an exemplary embodiment, the compound is described herein, or a salt, prodrug, hydrate or solvent thereof, or a combination thereof. In an exemplary embodiment, the invention provides a compound described herein, or a prodrug thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt, hydrate or solvent thereof. In an exemplary embodiment, the invention provides a compound described herein, or a salt thereof. In another exemplary embodiment, the compound of the invention is a compound described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the compound is a compound described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the compound is in accordance with a formula described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the compound is part of a combination described herein. In an exemplary embodiment, the compound is part of a pharmaceutical formulation described herein. In another exemplary modality, the disease is a systemic disease. In another exemplary modality, the disease is a topical disease. In an exemplary embodiment, the animal being administered the compound is otherwise not in need of treatment with the compound.
In an exemplary embodiment, the disease is treated by oral administration of a compound of the invention and/or a combination of the invention. In an exemplary embodiment, the disease is treated by intravenous administration of a compound of the invention and/or a combination of the invention. In an exemplary embodiment, the disease is treated by subcutaneous administration of a compound of the invention and/or a combination of the invention. Systemic Diseases
[00155] In another aspect, the invention provides a method of treating a systemic disease. The method involves contacting an animal with a compound of the invention and/or a combination of the invention.
[00156] In another exemplary embodiment, the disease is associated with a bacterium described here. In another exemplary modality, the disease is associated with infection by a Gram-positive bacterium. In an exemplary embodiment, the disease is associated with a species of Staphylococcus. In another exemplary modality, the disease is selected from the group consisting of pneumonia, gastroenteritis, toxic shock syndrome, community-acquired pneumonia (CAP), meningitis, septic arthritis, urinary tract infection, bacteremia, endocarditis, osteomelite, skin infection and skin structure. In an exemplary modality, the disease is associated with a species of Streptococcus. In another exemplary modality, the disease is selected from the group consisting of sore throat, skin infections, necrotizing fasciitis, toxic shock syndrome, pneumonia, otitis media and sinusitis. In an exemplary modality, the disease is associated with a species of Actinomyces. In another exemplary modality, the disease is actinomycosis. In an exemplary modality, the disease is associated with a species of Norcardia. In another exemplary modality, the disease is pneumonia. In an exemplary modality, the disease is associated with a species of Corynebacterium. In another exemplary modality, the disease is diphtheria. In an exemplary modality, the disease is associated with a species of Listeria. In another exemplary modality, the disease is meningitis. In an exemplary embodiment, the disease is associated with a Bacillus species. In another exemplary modality, the disease is anthrax or food poisoning. In an exemplary modality, the disease is associated with a species of Clostridium. In another exemplary modality, the disease is selected from the group consisting of botulism, tetanus, gas gangrene and diarrhea.
[00157] In an exemplary modality, the disease is associated with a species of Mycobacterium. In an exemplary modality, the disease is associated with Mycobacterium tuberculosis. In an exemplary modality, the disease is associated with Mycobacterium kansasii. In an exemplary embodiment, the disease is associated with Mycobacterium avium-intracellulare. In another exemplary modality, the disease is leprosy. In another exemplary modality, the disease is tuberculosis. In another exemplary modality, the disease is pulmonary tuberculosis. In another exemplary modality, the disease is extrapulmonary tuberculosis. In another exemplary modality, the disease is associated with multi-drug resistant tuberculosis. In another exemplary modality, the disease is associated with extensively drug-resistant tuberculosis.
[00158] In another exemplary modality, the disease is associated with infection by a Gram-negative bacterium. In an exemplary modality, the disease is associated with a species of Neisseria. In another exemplary modality, the disease is selected from the group consisting of meningitis, gonorrhea, extema otitis and folliculitis. In an exemplary modality, the disease is associated with a species of Escherichia. In another exemplary modality, the disease is selected from the group consisting of diarrhea, urinary tract infections, meningitis, sepsis and PAH. In an exemplary modality, the disease is associated with a species of Shigella. In another exemplary modality, the disease is selected from the group consisting of diarrhea, bacteremia, endocarditis, meningitis and gastroenteritis. In an exemplary modality, the disease is associated with a species of Salmonella. In another exemplary modality, the disease is selected from the group consisting of Typhoid fever, sepsis, gastroenteritis, endocarditis, sinusitis and meningitis. In an exemplary modality, the disease is associated with a species of Yersinia. In another exemplary modality, the disease is selected from the group consisting of Typhoid fever, bubonic plague, enteric fever and gastroenteritis. In an exemplary modality, the disease is associated with a species of Klebsiella. In another exemplary modality, the disease is sepsis or urinary tract infection. In an exemplary modality, the disease is associated with a species of Proteus. In another exemplary modality, the disease is a urinary tract infection. In an exemplary modality, the disease is associated with a species of Enterobacter. In another exemplary modality, the disease is a hospital-acquired infection. In an exemplary modality, the disease is associated with a species of Serratia. In another exemplary modality, the disease is selected from the group consisting of a urinary tract infection, skin and skin structure infection, and pneumonia. In an exemplary modality, the disease is associated with a species of Vibrio. In another exemplary modality, the disease is cholera or gastroenteritis. In an exemplary modality, the disease is associated with a species of Campylobacter. In another exemplary modality, the disease is gastroenteritis. In an exemplary embodiment, the disease is associated with a species of Helicobacter. In another exemplary modality, the disease is chronic gastritis. In an exemplary modality, the disease is associated with a species of Pseudomonas. In another exemplary modality, the disease is selected from the group consisting of pneumonia, osteomilitis, burn infections, sepsis, UTIs, endocarditis, otitis and corneal infections. In an exemplary modality, the disease is associated with a species of Bacteroides. In another exemplary modality, the disease is periodontal disease or aspiration pneumonia. In an exemplary modality, the disease is associated with a species of Haemophilus. In another exemplary modality, the disease is selected from the group consisting of meningitis, epiglottitis, septic arthritis, sepsis, chancroid and vaginitis. In an exemplary modality, the disease is associated with a species of Bordetella. In another exemplary modality, the disease is whooping cough. In an exemplary modality, the disease is associated with a species of Legionella. In another exemplary modality, the disease is pneumonia or pontiac fever. In an exemplary modality, the disease is associated with a species of Francisella. In another exemplary modality, the disease is tularemia. In an exemplary modality, the disease is associated with a species of Brucella. In another exemplary modality, the disease is brucellosis. In an exemplary modality, the disease is associated with a species of Pasteurella. In another exemplary embodiment, the disease is a skin infection. In an exemplary modality, the disease is associated with a species of Gardnerella. In another exemplary modality, the disease is vaginitis. In an exemplary modality, the disease is associated with a species of Spirochetes. In another exemplary modality, the disease is syphilis or Lyme disease. In an exemplary modality, the disease is associated with a species of Chlamydia. In another exemplary modality, the disease is chlamydia. In an exemplary modality, the disease is associated with a species of Rickettsiae. In another exemplary modality, the disease is Spotted Fever or Typhus.
[00159] In an exemplary modality, the disease is associated with Mycoplasma pneumoniae. In another exemplary modality, the disease is tracheobronchitis or walking pneumonia. In an exemplary modality, the disease is associated with Ureaplasma urealyticum. In another exemplary modality, the disease is urethritis. In another exemplary modality, the disease is pyelonephritis. In another exemplary modality, the disease is an intraabdominal infection. In another exemplary modality, the disease is febrile neutropenia. In another exemplary modality, the disease is a pelvic infection. In another exemplary modality, the disease is bacteraemia. In another exemplary modality, the disease is septicemia.
[00160] In an exemplary modality, the disease is an acute exacerbation of chronic obstructive pulmonary disease. In an exemplary modality, the disease is chronic obstructive pulmonary disease. In an exemplary modality, the disease is pharyngitis. In an exemplary modality, the disease is tonsillitis. In an exemplary modality, the disease is Acute Exacerbation of Chronic Bronchitis (AECB). In an exemplary modality, the disease is cervicitis. In an exemplary modality, the disease is genital ulcer disease.
[00161] In an exemplary modality, for any of the methods described above, the animal is selected from the group consisting of human, cattle, deer, reindeer, goat, honey bee, pig, sheep, horse, cow, bull, dog, guinea pig, gerbil, rabbit, cat, camel, yak, elephant, ostrich, otter, chicken, duck, goose, guinea fowl, pigeon, swan and turkey. In another exemplary embodiment, for any of the methods described above, the animal is selected from the group consisting of a human, cattle, goat, pig, sheep, horse, cow, bull, dog, guinea pig, gerbil, rabbit, cat, chicken and turkey. In another exemplary embodiment, for any of the methods described above, the animal is a human.
[00162] In an exemplary embodiment, for any of the methods described above, a compound of the invention, a combination of the invention, a compound described herein or a pharmaceutically acceptable salt thereof, or combination described herein, and/or a pharmaceutical formulation described herein. here it can be used. VII. Pharmaceutical Formulation
[00163] In another aspect, the invention provides a pharmaceutical formulation comprising: a) a compound of the invention; and b) a pharmaceutically acceptable excipient. In another aspect, the invention provides a pharmaceutical formulation comprising: a) a combination of the invention; and b) a pharmaceutically acceptable excipient. In an exemplary embodiment, the compound conforms to a formula described herein. In an exemplary embodiment, the compound is in accordance with an example described herein. In an exemplary embodiment, the compound of the invention or combination of the invention is a compound described herein or combination described herein, or a pharmaceutically acceptable salt thereof. In an exemplary embodiment, the compound of the invention is a compound described herein.
[00164] In an exemplary embodiment, the compound of the invention is present in a pharmaceutical formulation in an amount between about 0.0001% to about 60% (w/w). In an exemplary embodiment, the amount is between about 0.01% to about 10% (w/w). In an exemplary embodiment, the amount is between about 0.1% to about 10% (w/w). In an exemplary embodiment, the amount is between about 0.25% to about 6% (w/w). In an exemplary modality, the amount is between about 0.5% to about 5% (w/w). In an exemplary modality, the amount is between about 0.1% and about 1.0% (w/w). In an exemplary modality, the amount is between about 1.0% and about 2.0% (w/w). In an exemplary modality, the amount is between about 2.0% and about 3.0% (w/w). In an exemplary modality, the amount is between about 3.0% and about 4.0% (w/w). In an exemplary modality, the amount is between about 4.0% and about 5.0% (w/w).
[00165] The pharmaceutical formulations of the invention may have a variety of forms adapted to the chosen route of administration. Those skilled in the art will recognize various synthetic methodologies that can be employed to prepare non-toxic pharmaceutical formulations incorporating the compounds described herein. Those skilled in the art will recognize a wide variety of non-toxic pharmaceutically acceptable solvents that can be used to prepare solvates of the compounds of the invention, such as water, ethanol, propylene glycol, mineral oil, vegetable oil and dimethylsulfoxide (DMSO).
The compositions of the invention may be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles. It is further understood that the best method of administration may be a combination of methods. Oral administration in the form of a pill, capsule, elixir, syrup, lozenge, troche, or the like is particularly preferred. The term parenteral as used herein includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, spinal, intrathecal or other injections or infusion techniques.
[00167] Pharmaceutical formulations containing compounds of the invention are preferably in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs .
[00168] Compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical formulations, and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents to provide pharmaceutically elegant and palatable preparations. Tablets may contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. Such excipients can be, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; lubricating agents, for example magnesium stearate, stearic acid or talc; and extenders and bulking agents such as microcrystalline cellulose. The tablets can be uncovered or they can be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed.
[00169] Formulations for oral use may also be presented as hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent, eg calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules in which the active ingredient is mixed with water or an oleic medium, for example peanut oil, liquid paraffin or olive oil.
[00170] Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; and dispersing or wetting agents, which may be a naturally occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with aliphatic alcohols of long chain, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides , for example polyethylene sorbitan monooleate. Aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
[00171] Oleic suspensions may be formulated by suspending the active ingredients in a vegetable oil, for example peanut oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. Oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or acetyl alcohol. Sweetening agents such as those shown above, and flavoring agents can be added to palatable oral preparations. Such compositions can be preserved by the addition of an antioxidant such as ascorbic acid.
[00172] Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Other dispersing agents include hydrophilic polymers, electrolytes, TweenTM 60 or 80, PEG, polyvinylpyrrolidone (PVP; commercially known as PlasdoneTM), and carbohydrate-based dispersing agents such as, for example, hydroxypropylcellulose and hydroxypropylcellulose ethers (for example, HPC, HPC-SL, and HPC-L), hydroxypropylmethylcellulose and hydroxypropylmethylcellulose ethers (eg, HPMC K100, HPMC K4M, HPMC K15M, and HPMC K100M), carboxymethylcellulose sodium, methylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate, non-stearate crystalline, magnesium aluminum silicates, triethanolamine, polyvinyl alcohol (PVA), polyvinylpyrrolidone/vinyl acetate copolymer (PlasdoneTM eg S-630), 4-(1,1,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde (also known as tyloxapol), poloxamers (eg Pluronics F68TM, F88TM and F108TM, which are ethylene oxide block copolymers and propylene oxide); and poloxamines (eg, Tetronic 9080, also known as Poloxamine 9080, which is a tetrafunctional block copolymer derived from sequential addition of propylene oxide and ethylene oxide to ethylenediamine (BASF Corporation, Parsippany, N.J.)). Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
[00173] Pharmaceutical formulations of the invention may also be in the form of oil-in-water emulsions and water-in-oil emulsions. The oleic phase may be a vegetable oil, for example olive oil or peanut oil, or a mineral oil, for example liquid paraffin or mixtures thereof. Suitable emulsifying agents may be naturally occurring gums, for example acacia gum or gum tragacanth; naturally occurring phosphatides, for example soy oil, lecithin, and esters or partial esters derived from fatty acids and hexitol; anhydrides, for example sorbitan monooleate; and condensation products of said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. Emulsions can also contain sweetening and flavoring agents.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, and flavoring and coloring agents. Pharmaceutical formulations may be in the form of a sterile injectable aqueous or oleaginous suspension. Such a suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents, which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. Furthermore, sterile, fixed oils are conventionally employed as a solvent or suspension medium. For this purpose any bland fixed oil including synthetic mono and diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.
[00175] The composition of the invention may also be administered in the form of suppositories, eg for rectal administration of the drug. These compositions can be prepared by mixing the drug with a non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are cocoa butter and polyethylene glycols.
[00176] Alternatively, the compositions may be administered parenterally in a sterile medium. The drug, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
For administration to non-human animals, the composition containing the therapeutic compound can be added to the animal's food or the animal's drinking water. Also, it will be convenient to formulate the animal's food and drinking water products so that the animal takes in an appropriate amount of the compound in its diet. It will additionally be convenient to present the compound in a composition as a premix for addition to food or drinking water. The composition can also be added with a human food or beverage supplement.
Dosage levels on the order of from about 5 mg to about 250 mg per kilogram of body weight per day, and more preferably from about 25 mg to about 150 mg per kilogram of body weight per day, are useful in treatment of the conditions indicated above. The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form will vary depending on the condition being treated and the particular mode of administration. Dosage unit forms will generally contain between from about 1 mg to about 500 mg of an active ingredient.
[00179] Dosing frequency may also vary depending on the compound used and the particular disease treated. However, for treatment of most disorders, a dosage regimen of 4 times daily or less is preferred. It will be understood, however, that the specific dose level for any particular patient will depend on a variety of factors including the activity of the specific compound employed, age, body weight, general health, sex, diet, time of administration, route of administration and excretion rate, drug combination, and severity of the particular disease undergoing therapy.
Preferred compounds of the invention will have desirable pharmacological properties which include, but are not limited to, oral bioavailability, lower toxicity, lower serum protein binding and desirable in vitro and in vivo half lives. Blood-brain barrier penetration for compounds used to treat CNS disorders is required, while lower brain levels of compounds used to treat peripheral disorders are often preferred.
[00181] The amount of composition required for use in the treatment will not only vary with the particular compound selected, but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attending physician or clinician.
[00182] In an exemplary embodiment, the pharmaceutical composition described herein includes an additional active ingredient. In another exemplary embodiment, the additional active ingredient is a compound that has been approved for human use by the United States Food and Drug Administration. In another exemplary embodiment, the additional active ingredient is an immunosuppressive agent. In yet another exemplary modality, the additional active ingredient is selected from the group consisting of corticosteroids, aminosalicylates, azathioprine (6-mercaptopurine), methotrexate and cyclosporine, etanorcept, infliximab, adalimumab, alefacept, efalizumab, and anakinra.
[00183] In yet another exemplary modality, the additional active ingredient is selected from the group consisting of betamethasone, tacrolimes and pimecrolimes. In yet another exemplary embodiment, the additional active ingredient is selected from the group consisting of an activated vitamin D analogue and an arotinoid (an aromatic retinoic acid analogue). In yet another exemplary embodiment, the additional active ingredient is carcipotriol, such as Tazorac (tazarotene). VII. a) Topical formulations
[00184] In a preferred embodiment, the methods of the invention can be employed through the topical application of the compounds described herein. Topical administration includes, for example, transmucosal, transdermal, ungual and transungual administration routes. Topical compositions useful in the present invention can be made into a wide variety of product types. These include, but are not limited to, lotions, creams, gels, sticks, sprays, ointments, pastes, foams, mousses, masks, eye creams, eye or ear drops, impregnated dressings, wipes, cleansers including soaps, body washes and shampoos, and makeup products, such as foundations, blushes, lipsticks, and eye shadows, among others. These types of products can comprise various types of carrier systems including, but not limited to, particles, nanoparticles and liposomes. If desired, disintegrating agents can be added, such as cross-linked polyvinyl pyrrolidone, agar or alginic acid or a salt thereof such as sodium alginate. Techniques for formulation and administration can be found in Remington: The Science and Practice of Pharmacy, supra. The formulation can be selected to maximize delivery to a target site in the body. The formulations can also include various conventional colorants, fragrances, thickeners, preservatives, humectants, emollients, demulcents, solubilizing excipients, dispersants, penetration enhancers, plasticizers, preservatives, stabilizers, demulsifiers, wetting agents, sunscreens, emulsifiers, moisturizers, astringents , deodorants, and others, which can be added to provide additional benefits such as, for example, improving the feel and/or appearance of the topical preparation.
[00185] Lotions, which are preparations that are to be applied to the skin, nail, hair, sharp nail surface or foot without friction, typically are liquid or semi-liquid preparations in which finely divided solid, waxy, or liquid are dispersed. Lotions will usually contain suspending agents to produce better dispersions as well as compounds useful to locate and maintain the active agent in contact with the skin, nail, hair, sharp nail or foot, eg, methylcellulose, sodium carboxymethylcellulose, or others.
[00186] Creams containing the active agent for delivery according to the invention are viscous liquids or semi-solid emulsions, oil-in-water or water-in-oil. Cream bases are water washable and contain an oil phase, an emulsifier and an aqueous phase. The oil phase is generally comprised of petrolatum or a fatty alcohol, such as cetyl or stearyl alcohol; the aqueous phase usually, though not necessarily, exceeds the oil phase by volume, and generally contains a humectant. The emulsifier in a cream formulation, as explained in Remington: The Science and Practice of Pharmacy, supra, is usually a nonionic, anionic, cationic or amphoteric surfactant.
[00187] Creams, which are semi-solid preparations, are usually based on petrolatum or other petroleum derivatives. As will be appreciated by one of ordinary skill in the art, the specific cream base to be used is one that provides optimal delivery for the active agent chosen for a given formulation, and preferably provides other desired characteristics as well, eg emollient or other . As with other carriers or vehicles, a cream base must be inert, stable, non-irritating and non-sensitizing. As explained in Remington: The Science and Practice of Pharmacy, 19th Ed. (Easton, Pa.: Mack Publishing Co., 1995), at pages 1399-1404, cream bases can be grouped into four classes: oil bases; emulsifiable bases; emulsion bases; and water-soluble bases. Oily cream bases include, for example, vegetable oils, fats obtained from animals, and semi-solid hydrocarbons obtained from petroleum. Preferred water-soluble cream bases are prepared from polyethylene glycols of varying molecular weight; again, reference can be made to Remington: The Science and Practice of Pharmacy, supra, for additional information.
[00188] Useful formulations of the invention also encompass sprays and aerosols. Sprays generally provide the active agent in an aqueous and/or alcoholic solution that can be applied to the skin, nail, hair, sharp nail or foot for delivery. Such sprays include those formulated to provide concentration of the active agent solution at the site of administration upon delivery, for example, the spray solution can be composed primarily of alcohol or other volatile liquid in which the drug or active agent can be dissolved. Upon delivery to the skin, nail, hair, sharp nail or foot, the carrier evaporates, leaving concentrated active agent at the site of administration. Examples of aerosol technology as described in United States patents US 6,682,716; 6,716,415; 6,716,417; 6,783,753; 7,029,658; and 7,033,575.
[00189] Examples of solubilizing excipients include polyethoxylated fatty acids, PEG fatty acid diesters, PEG fatty acid monoester and diester blends, polyethylene glycol glycerol fatty acid esters, alcohol oil transesterification products, polyglycerized fatty acids , propylene glycol fatty acid esters, mixtures of propylene glycol esters-glycerol esters, mono- and diglycerides, sterol and sterol derivatives, sorbitan fatty acid esters of polyethylene glycol, alkyl ethers of polyethylene glycol, esters of sugar, polyethylene glycol alkyl phenols, polyoxyethylene-polyoxypropylene block copolymers, sorbitan fatty acid esters, lower alcohol fatty acid esters, ionic surfactants, tocopherol esters, and sterol esters.
[00190] Exemplary modalities are summarized below.
em que R3 é nitroalquila substituída ou não-substituída ou aminoalquila substituída ou não-substituída; R4 é selecionado a partir do grupo consistindo em halogênio, alquila não-substituída, alcóxi não- substituído, e fenila não-substituída; Y é O ou S; e R5 é selecionado a partir do grupo consistindo em alquila substituída ou não-substituída e heteroalquila substituída ou não-substituída; ou um sal, hidrato ou solvato dos mesmos.[00191] In an exemplary embodiment, the invention provides a compound having a structure in accordance with the formula which is: wherein R3 is substituted or unsubstituted nitroalkyl or substituted or unsubstituted aminoalkyl; R4 is selected from the group consisting of halogen, unsubstituted alkyl, unsubstituted alkoxy, and unsubstituted phenyl; Y is O or S; and R5 is selected from the group consisting of substituted or unsubstituted alkyl and substituted or unsubstituted heteroalkyl; or a salt, hydrate or solvate thereof.
em que C* é um estereocentro de átomo de carbono que tem uma configuração que é (R) ou (S).[00192] In an exemplary modality, in accordance with the paragraph above having a structure that is where C* is a carbon atom stereocenter that has a configuration that is (R) or (S).
[00193] In an exemplary embodiment, in accordance with any of the above paragraphs, wherein the C* stereocenter is in an (S) configuration.
[00194] In an exemplary embodiment, in accordance with any of the above paragraphs, wherein R3 is -(CR20R21)nNR22R23 wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ; each R20 and each R21 is independently selected from the group consisting of H, R ,OR , NR R , SR , -S(O)R , -S(O)2R , -S(O )2NR26R27, -C(O)R27, -C(O)OR27, and -C(O)NR26R27 R22 and R23 are independently selected from the group consisting of H, -S(O)R28, -S(O) 2R28, -S(O)2NR28R29, -C(O)R28, -C(O)OR28, -C(O)NR28R29, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl , substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; wherein each R26, each R27, each R28 and each R29 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl substituted, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[00195] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2.
[00196] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2, and C* has a configuration that is (S).
[00197] [0003] In an exemplary embodiment, in accordance with any of the above paragraphs, R4 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and sec-butyl.
[00198] In an exemplary embodiment, in accordance with any of the above paragraphs, R4 is selected from the group consisting of fluorine, chlorine, bromine, and iodine.
[00199] [0004] In an exemplary modality, according to any of the above paragraphs, R4 is fluorine.
[00200] In an exemplary embodiment, in accordance with any of the above paragraphs, R4 is chlorine.
[00201] [0005] In an exemplary embodiment, in accordance with any of the above paragraphs, R4 is bromo.
halogênio, ciano, amidino, OR , NR R , SR , -N(R )S(O)2R , -C(O)R , - C(O)OR7, -C(O)NR7R8 em que cada R7 e cada R8 é independentemente selecionado a partir do grupo consistindo em H, alquila substituída ou não- substituída, heteroalquila substituída ou não-substituída, cicloalquila substituída ou não-substituída, heterocicloalquila substituída ou não- substituída, arila substituída ou não-substituída, e heteroarila substituída ou não-substituída.[00202] In an exemplary modality, according to any of the above paragraphs, R5 is: halogen, cyano, amidino, OR , NR R , SR , -N(R )S(O)2R , -C(O)R , -C(O)OR7, -C(O)NR7R8 where each R7 and each R8 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted heteroaryl or unsubstituted.
[00203] In an exemplary modality, according to any of the above paragraphs, a is 1, 2, 3, 4, or 5.
[00204] In an exemplary modality, according to any of the above paragraphs, a is 2, 3, or 4.
[00205] In an exemplary embodiment, in accordance with any of the above paragraphs, each R10 and each R11 is independently selected from the group consisting of H, substituted or unsubstituted alkyl, OH, and NH2.
[00206] In an exemplary modality, in accordance with any of the above paragraphs, each R10 and each R11 is H.
[00207] In an exemplary embodiment, in accordance with any of the above paragraphs, R12 is selected from the group consisting of H, OH, NH2, methyl, ethyl, -NHS(O)2CH3, cyano, -NHC(O) CH3, -NHC(O)NHCH2CH3, -C(O)NH2, -C(O)OH, 4-(methoxy)phenyl, benzyl, benzoxy, -NHC(O)OCH2Ph, -C(O)NHCH2CH2OH and -C (NH2)(NH).
[00208] In an exemplary modality, according to any of the above paragraphs, Y is O.
[00209] In an exemplary embodiment, in accordance with any of the above paragraphs, R5 is unsubstituted alkyl.
[00210] In an exemplary embodiment, in accordance with any of the above paragraphs, R5 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, and sec-butyl.
[00211] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2; and Y is O; and R5 is substituted or unsubstituted alkyl.
[00212] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2; and R4 is halogen.
[00213] In an exemplary embodiment, in accordance with any of the above paragraphs, R4 is halogen; Y is O; and R5 is unsubstituted alkyl.
[00214] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2, and C* has a configuration that is (S) and R4 is halogen.
[00215] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2, and C* has a configuration that is (S), R5 is unsubstituted alkyl, and R4 is halogen.
[00216] In an exemplary embodiment, in accordance with any of the above paragraphs, Y is O, R3 is -CH2NH2, and C* has a configuration that is (S), R5 is C1 or C2 or C3 or C4 non-alkyl substituted and R4 is halogen.
[00217] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2; R4 is chlorine; Y is O; and R5 is substituted or unsubstituted alkyl.
[00218] [0006] In an exemplary embodiment, in accordance with any of the above paragraphs, R3 is -CH2NH2; Y is O; and R5 is ethyl.
[00219] In an exemplary embodiment, according to any of the above paragraphs, the compound has a structure that is
[00220] In an exemplary embodiment, the invention provides a composition comprising: (a) a) a first stereoisomer of the compound according to any of the above paragraphs; b) at least one additional stereoisomer of the first stereoisomer; wherein the first stereoisomer is present in an enantiomeric excess of at least 80% with respect to said at least one additional stereoisomer.
[00221] In an exemplary embodiment, in accordance with any of the above paragraphs, wherein said enantiomeric excess is at least 92%.
[00222] In an exemplary embodiment, in accordance with any of the above paragraphs, wherein the C* stereocenter of the first stereoisomer is in an (S) configuration.
[00223] In an exemplary embodiment, in accordance with any of the above paragraphs, wherein R3 is -CH2NH2.
[00224] In an exemplary embodiment, the invention provides a composition according to any of the above paragraphs, wherein the C* stereocenter is in an (S) configuration, and said composition is substantially free of the (R) enantiomer of the compound .
[00225] In an exemplary embodiment, the invention provides a combination comprising the compound according to any one of the above paragraphs, or a pharmaceutically acceptable salt thereof, together with at least one other therapeutically active agent.
[00226] In an exemplary embodiment, the invention provides a pharmaceutical formulation comprising: (a) a compound according to any one of the above paragraphs, or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable excipient.
[00227] [0007] In an exemplary embodiment, in accordance with any of the above paragraphs, the formulation is in unit dosage form.
[00228] In an exemplary embodiment, in accordance with any of the above paragraphs, the formulation is for oral or topical use.
[00229] In an exemplary embodiment, the invention provides a method of inhibiting an enzyme, comprising: contacting the enzyme with the compound according to any of the above paragraphs, thereby inhibiting the enzyme.
[00230] In an exemplary embodiment, according to any of the above paragraphs, the enzyme is a t-RNA synthetase that comprises an editing domain.
[00231] In an exemplary embodiment, according to any of the above paragraphs, the enzyme is a leukilla t-RNA synthetase.
[00232] In an exemplary embodiment, the invention provides a method for killing and/or preventing the growth of a micro-organism, comprising: contacting the micro-organism with an effective amount of a compound according to any of the above paragraphs, or a pharmaceutically acceptable salt thereof, thereby killing and/or preventing the growth of the microorganism.
[00233] In an exemplary embodiment, according to any of the above paragraphs, the micro-organism is a bacterium.
[00234] [0008] In an exemplary embodiment, according to any of the above paragraphs, the microorganism is Mycobacterium tuberculosis.
[00235] In an exemplary embodiment, the invention provides a method of treating and/or preventing a disease in an animal, comprising: administering to the animal a therapeutically effective amount of the compound according to any one of the above paragraphs, or a pharmaceutically acceptable salt of the same, thus treating and/or preventing the disease.
[00236] In an exemplary modality, according to any of the above paragraphs, the disease is tuberculosis.
[00237] In an exemplary modality, according to any of the above paragraphs, the animal is a human being.
[00238] In an exemplary embodiment, the invention provides a method for inhibiting the editing domain of a t-RNA synthetase, comprising: contacting the synthetase with an effective amount of a compound according to any one of the above paragraphs, or a pharmaceutically acceptable salt thereof, thereby inhibiting synthetase.
[00239] In an exemplary embodiment, according to any of the above paragraphs, the synthetase is a leukilla t-RNA synthetase.
[00240] In an exemplary embodiment, in accordance with any of the above paragraphs, the synthetase is a leukilla t-RNA synthase of Mycobacterium tuberculosis.
[00241] In an exemplary embodiment, the invention provides for the use of a compound according to any of the above paragraphs or a combination according to any of the above paragraphs or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment and/or prophylaxis of a bacterial infection.
[00242] It is to be understood that the present invention covers all such combinations of aspects and/or modalities, as well as suitable, convenient and preferred groups described herein.
[00243] The invention is further illustrated by the following examples. The examples are not intended to define or limit the scope of the invention. EXAMPLES
[00244] Proton NMR is recorded on the Varian AS 300 spectrometer and chemical shifts are reported as low δ field (ppm) from tetra-methylsilane. Mass spectra are determined on Micromass Quattro II.
The M.tuberculosis LeuRS gene (DNA sequence listed here) was prepared by GenScript and cloned into the T7 expression vector ET28a(+) at the NdeI-XhoI sites. Overexpression of M. tuberculosis LeuRS from this construct generated an N-terminal his-tagged version of M. tuberculosis LeuRS, which will use standard procedures for purification of his-tagged proteins. EXAMPLE 1 A. 3-Aminomethyl-4-fluoro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol; 6-Fluoro-2,3-dimethoxy-benzaldehyde bis trifluoroacetic salt
[00246] To a solution of 4-fluoro-1,2-dimethoxy-benzene (20.0 g, 128.07 mmols) in anhydrous THF (200 mL) under nitrogen at -78°C was added a solution dropwise to 2.5 M in n-BuLi hexane (102.4 mL, 256.14 mmols) for 30 min duration and the reaction mixture was further stirred at the same temperature for 3 h. The reaction mixture was carefully quenched with DMF (100 mL) at -65°C to -40°C and left overnight. 2N HCl (300 mL) was added dropwise at -60°C and the mixture stirred for 30 min. The two layers were separated and the aqueous layer extracted with EtOAc. The combined organic layers were washed with water and brine, dried over MgSO4, filtered and concentrated in vacuo. Purification was completed by flash column chromatography (20% EtOAc/hexane). Yield 18.0 g (85%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.39 (s, 1H), 7.09 (dd, J=9.4, 5.1Hz, 1H), 6.84 (t, J=9.6Hz, 1H), 3.98( s, 3H), 3.88 (s, 3H). 19F NMR (376 MHz, CHLOROFORM-d): -126 ppm. 6-Fluoro-2,3-dihydroxy-benzaldehyde
To a solution of 6-Fluoro-2,3-dimethoxy-benzaldehyde (18.0 g, 97.74 mmols) in anhydrous dichloromethane (100 mL) under nitrogen at -60°C was added BBr3 dropwise. OEt2 (195 mL, 195.48 mmols) for 30 min and the solution was allowed to warm to room temperature and stirred for 4h. The reaction mixture was cooled to -60°C and 2N HCl (250 mL) was carefully added dropwise. The mixture was stirred at room temperature overnight. The two layers were separated and the aqueous layer extracted with DCM. The combined organic layers were washed with water, salt. The NaHCO3 solution, water and brine is dried over MgSO4. The solvent was removed in vacuo to provide the title compound which was used in the next step without further purification. Yield 11.15 g (74%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 11.53 (s, 1H), 10.23 (s, 1H), 7.11 (dd, J=8.8, 5.3Hz, 1H), 6.57 (t, J=9.6 Hz, 1H), 5.48 (s, 1H). 19F NMR (376 MHz, CHLOROFORM-d): -132 ppm. 3-(3-Benzyloxy-propoxy)-6-fluor-2-hydroxy-benzaldehyde
[00248] To a solution of 6-fluoro-2,3-dihydroxy-benzaldehyde (11.15 g, 71.42 mmols) in anhydrous DMSO (88 mL) under nitrogen were sequentially added sodium t-butoxide (13 .72 g, 142.84 mmols) and benzyl-3-bromopropyl ether (17.29 g, 78.56 mmols) and the reaction mixture stirred at room temperature for 18 h. The mixture was diluted with water (400ml) and extracted with EtOAc (4x100ml). The combined organic layer was washed with water and brine, dried over MgSO4, filtered and concentrated in vacuo. Purification was completed by flash chromatography (20% EtOAc/hexane). Yield 11.5 g (77%).1H NMR (400 MHz, CHLOROFORM-d) δ ppm 11.62 (s, 1H), 10.23 (s, 1H), 7.42 - 7.16 (m, 5H), 7.05 (dd, J=8.8, 5.3Hz, 1H), 6.54 (t, J=9.6Hz, 1H), 4.52 (s, 2H), 4.13 (t, J=6.3Hz, 2H), 3.68( t, J=6.1Hz, 2H), 2.12 (quin, J=6.2Hz, 2H). 19F NMR (376 MHz, CHLOROFORM-d): -132 ppm. 6-(3-Benzyloxy-propoxy)-3-fluoro-2-formyl-phenyl ester of trifluoro-methanesulfonic acid
[00249] Trifluoromethanesulfonic anhydride (1.11 g, 3.94 mmols) was added dropwise to a solution of pyridine (389 mg, 4.92 mmols) and 3-(3-benzyloxy-propoxy)-6-fluor- 2-hydroxy-benzaldehyde (1 g, 3.28 mmols) in CH 2 Cl 2 (5 mL) at 0°C (bath temperature). The reaction mixture was then allowed to warm to room temperature and was stirred until complete consumption of starting material (as determined by TLC). Et2O and 2N HCl were then added. The organic layer was separated and washed with saturated NaHCO3 then brine. The organic layer was dried (Na2SO4) and filtered through a short silica gel plug, washing with Et2O. The filtrate was concentrated in vacuo to provide 1.10 g of the desired triflate (76% yield) which was used directly without further purification. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.32 (s, 1H), 7.44 - 7.21 (m, 7H), 4.51 (s, 2H), 4.18 (t, J=6.1Hz, 2H) , 3.68 (t, J=5.7Hz, 2H), 2.14 (quin, J=5.8Hz, 2H). 3-(3-Benzyloxy-propoxy)-6-fluor-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
To a solution of 6-(3-benzyloxy-propoxy)-3-fluoro-2-formyl-phenyl ester of trifluoro-methanesulfonic acid (1.092 g, 2.50 mmols) in anhydrous 1,4-dioxane (10 ml) were added bis(pinacolato)diboron (953 mg, 3.75 mmols) and KOAc (736 mg, 7.50 mmols) at room temperature, then degassed with N2 for 20 min. PdCl2(dppf) (46 mg, 8% in mol) was added and the resulting solution was stirred at 100°C until the reaction was complete. The solution was cooled to room temperature, filtered through Celite® or silica gel and concentrated in vacuo. The residue was taken up in EtOAc. The organic layer was then washed with H2O, then brine, dried (Na2SO4), filtered, and concentrated in vacuo. The product was purified by flash chromatography (20% EtOAc/hexane) to provide 0.5 g of the title compound along with detriflate for product ratio ~1:1 by 1 H NMR Spectrum. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.33 (s, 1H), 7.41 - 7.23 (m, 6H), 7.19 (d, J=9.4Hz, 1H), 4.57 - 4.42 (m, 2 H), 4.06 (t, J=6.3 Hz, 2H), 3.69 - 3.64 (m, 2H), 2.20 - 2.00 (m, 2H), 1.44 (s, 12H); 19F NMR (376 MHz, CHLOROFORM-d) δppm -73.72. 7-(3-Benzyloxy-propoxy)-4-fluoro-3-nitromethyl-3H-benzo[C] [1,2]oxaborol-1-ol

[00251] NaOH (48 mg, 1.20 mmol) was added to 3-(3-benzyloxy-propoxy)-6-fluor-2-(4,4,5,5-tetramethyl-[1,3,2] dioxaborolan-2-yl)-benzaldehyde (500 mg, 1.2 mmol) in H2O (3 mL) at room temperature, and the reaction mixture was stirred at room temperature for 5 min. MeNO2 (219 mg, 3.6 mmols) was added dropwise and the mixture was stirred at room temperature for 16 h. The reaction mixture was acidified with 2N HCl and extracted with EtOAc. The organic fraction was washed with H2O, then brine, dried (MgSO4), and concentrated in vacuo. Purification was by flash chromatography (10 to 40% EtOAc/hexane) to provide 120 mg of the title compound by 1 H NMR spectrum. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.40-7.22 (m, 5H), 7.11 (t, J=8.8Hz, 1H), 6.81 (t, J=8.6Hz, 1H), 5.93( dd, J=9.0, 2.3 Hz, 1H), 4.99 (dd, J=13.1, 2.5Hz, 1H), 4.62 - 4.53 (m, 2H), 4.43 (dd, J=12.9, 9.0 Hz, 1 H), 4.19-4.01 (m, 2H), 3.66 (dt, J=15.9, 5.7Hz, 2H), 2.18 - 1.94 (m, 2H); 19F NMR (376 MHz, CHLOROFORM-d) δppm -72.81 (s, 1F); MS (ESI) m/z = 374 (M - 1, negative). 3-Aminomethyl-4-fluoro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol; bis-trifluoroacetic acid salt

[00252] A mixture of 7-(3-benzyloxy-propoxy)-4-fluoro-3-nitromethyl-3H-benzo[C][1,2]oxaborol-1-ol (120 mg, 0.32 mmol) and 20% Pd(OH) 2 (120 mg, 1:1 w/w substrate to catalyst) in AcOH (10 mL) was shaken under an atmosphere of H 2 (45 to 50 psi) (0.31 to 0.35 MPa ) on a Parr shaker. Once the reaction was complete, the mixture was filtered through Celite®. The filtrate was concentrated in vacuo to provide a gummy material. The remaining AcOH was removed by coevaporation with toluene (3x) to furnish the amine. Purification by preparative HPLC (0.1% aq CF3CO2H/CH3CN) yielded 12 mg of the title compound as a white solid (8.4% yield). 1H NMR (400 MHz, DMSO-d6) δ ppm 9.14 (br.s., 1H), 8.02 (br.s., 3H), 7.25 (d, J=7.8Hz, 1H), 6.93 (d , J=7.4Hz, 1H), 5.43 (br.s., 1H), 4.55 (br.s., 1H), 4.07 (br.s., 2H), 3.56 (br.s., 1H), 2H), 3.42 - 3.37 (m, 1H), 2.95 (br.s., 1H), 1.86 (br.s., 2H); 19F NMR (376 MHz, DMSO-d6) δ ppm -73.90 (s, 6F), -131.51 (s, 1F); MS (ESI) m/z = 256 (M + 1, positive); HPLC purity: 95.65% (MaxPlot 200 at 400 nm), 96.63% (220 nm). B. 3-(Ammomethyl)-4-chloro-7-(3-hydroxypropoxy)benzo[c][1,2]oxaborol-1(3H)-ol 3-(3-benzyloxy-propoxy)-2-hydrochloride hydroxy-benzaldehyde

[00253] NaH (2.95 g, 72.4 mmols) was added to an ice cooled solution of 2,3-dihydroxybenzaldehyde (5.0 g, 36 mmols) in anhydrous DMSO (45 mL). Benzyl-3-bromopropyl ether (6.45 mL, 36.2 mmols) was then added and the mixture was stirred at room temperature for 12 h. The mixture was neutralized using 1N HCl and then extracted with EtOAc. The organic fraction was washed with H2O and concentrated in vacuo. The residue was purified by flash chromatography (8:2 hexane/EtOAc) to provide the title compound as a brown oil: yield 8.40 g (81%). 1H NMR (400 MHz, CDCl 3 ) δ (ppm): 9.93 (s, 1H), 7.36-7.23 (m, 6H), 7.20-7.16 (m, 2H), 6.98-6.91 (m, 1H), 4.53 (s , 2H), 4.19 (t, J = 6.2 Hz, 2H), 3.70 (t, J = 6.1 Hz, 2H), 2.19-2.16 (m, 2H). 3-(3-benzyloxy-propoxy)-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde BO CHO OB

Trifluoromethanesulfonic anhydride (4.60 mL, 27.9 mmols) was added dropwise To a solution of pyridine (3.42 mL, 42.5 mmols) and 3-(3-benzyloxy-propoxy)-2- hydroxy-benzaldehyde (7.6 g, 26 mmols) in CH 2 Cl 2 (200 mL) at 0°C (bath temperature). The reaction mixture was then allowed to warm to room temperature and was stirred until complete consumption of starting material (as determined by TLC). Et2O and 2N HCl were then added. The organic layer was separated and washed with saturated NaHCO3 then brine. The organic layer was dried (Na2SO4) and filtered through a short silica gel plug, washing with Et2O. The filtrate was concentrated in vacuo to provide 8.60 g of the desired triflate (77% yield) which was used directly without further purification. 1H NMR (400 MHz, CDCl 3 ) δ (ppm): 10.23 (s, 1H), 7.54-7.47 (m, 1H), 7.43 (t, J = 8.0 Hz, 1H), 7.36-7.22 (m, 6H), 4.52 (s, 2H), 4.23 (t, J = 6.3 Hz, 2H), 3.71 (t, J = 6.1 Hz, 2H), 2.21-2.17 (m, 2H).
To a solution of trifluoro-methanesulfonic acid 2-(3-benzyloxy-propoxy)-6-formyl-phenyl ester (8.0 g, 19 mmol) in anhydrous 1,4-dioxane (160 mL) was added. bis(pinacolato)diboron (9.71 g, 38.2 mmols) and KOAc (5.71 g, 57.4 mmols) at room temperature, then degassed with N2 for 20 min. PdCl2(dppf) (1.39 g, 1.89 mmol) was added and the resulting solution was stirred at 100°C until the reaction was complete. The solution was cooled to room temperature, filtered through Celite® or silica gel and concentrated in vacuo. The residue was taken up in EtOAc. The organic layer was then washed with H2O, then brine, dried (Na2SO4), filtered, and concentrated in vacuo. The product was purified by flash chromatography (9:1 hexane/EtOAc) to provide 4.80 g of the title compound (43% yield) along with some pinacol contamination and was used without further purification. 1H NMR (400 MHz, CDCl 3 ) δ (ppm): 9.93 (s, 1H), 7.46 (t, J = 7.8 Hz, 1H), 7.41-7.36 (m, 1H), 7.35-7.24 (m, 5H), 7.08 (d, J = 7.8 Hz, 1H), 4.50 (s, 2H), 4.10 (t, J = 6.3 Hz, 2H), 3.67 (t, J = 6.3 Hz, 2H), 2.11 (quin, J = 6.2 Hz, 2H), 1.43 (s, 12H). 7-(3-benzyloxy-propoxy)-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol

[00256] NaOH aq. (NaOH (3.64 g, 83 mmols) was added to 3-(3-benzyloxy-propoxy)-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl) - benzaldehyde (36 g, 91 mmols) in H2O (180 mL), and THF (50 mL) at room temperature, and the reaction mixture was stirred at room temperature for 5 min. MeNO2 (16.6 g, 273 mmols) was added dropwise and the mixture was stirred at room temperature for 16 h. The reaction mixture was acidified with 2N HCl and extracted with EtOAc. The organic fraction was washed with H2O then brine, dried (MgSO4), and concentrated in vacuo. Purification was by flash chromatography (1:1 hexane/EtOAc) to provide 15.9 g of the title compound as a pale yellow oil (50% yield).1H NMR (400 MHz, DMSO-d6 δ ppm: 9.05 (s, 1H), 7.44 (t, J = 7.8 Hz, 1H), 7.35-7.20 (m, 5H), 7.06 (d, J = 7.4 Hz, 1H), 6.88 (d, J = 8.2 Hz, 1H), 5.70 (dd, J = 9.4, 2.3 Hz, 1H), 5.29 (dd, J = 13.7, 2.7 Hz, 1H), 4.53 (dd, J = 13.3, 9.4 Hz, 1H), 4.45 ( s, 2H), 4.11 (t, J = 6.1 Hz, 2H), 3.60 (t, J = 6.3 Hz, 2H), 2.04-1.91 (m, 2H); MS (ESI): m/z = 356 (M-1, negative); HPLC purity: 99.35% (MaxPlot 200-400 nm), 97.32% (220 nm). 4-Chloro-7-(3-hydroxy-propoxy)-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol OH

[00257] 7-(3-Benzyloxy-propoxy)-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (1.1 g, 3.0 mmols) in glacial AcOH (10 ml) in an ice-water bath was added SO2Cl2 (0.7 ml, 9.07 mmols) dropwise over a period of 5 minutes. The resulting solution was stirred for 30 minutes at the same temperature, then 1.5 h at room temperature. The solution was quenched with crushed ice and then diluted with EtOAc (100 mL). The organic layer was washed with water, dried over Na2SO4, filtered and concentrated under reduced pressure. To the crude residue in MeOH (20 mL) was added Pd(OH)2 (10% w/w on carbon, 0.7 g), conc HCl was added until the pH was 1, and the reaction vessel was pressurized to 40 psi (0.28 MPa) with hydrogen for 30 minutes at room temperature. The resulting mixture was filtered through a pad of Celite® and washed with EtOAc. The filtrate was concentrated in vacuo then the residue was purified by silica gel column chromatography (EtOAc:Hex, 1:1) providing the title compound (0.2 g, 24% over 2 steps). 1H NMR (400 MHz, DMSO-d6) δ ppm 9.31 (br.s., 1H), 7.49 (d, J=8.2Hz, 1H), 6.98 (d, J=8.6Hz, 1H), 5.76 (dd, J=8.2, 2.7Hz, 1H), 5.33 (dd, J=13.2, 2.3Hz, 1H), 4.70 (dd, J=13.0, 8.4Hz, 1H), 4.55 (br.s. , 1H), 4.15 - 4.05 (m, 2H), 3.61 - 3.55 (m, 2H), 1.95 - 1.77 (m, 2H). 3-Aminomethyl-4-chloro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol hydrogen chloride

[00258] A 4-Chloro-7-(3-hydroxy-propoxy)-3-nitromethyl-3H-benzo[c] [1,2]oxaborol-1-ol (105 mg, 0.35 mmol) in solution of methanolic ammonia (2M, 20 mL) was added Ra/Ni (0.15 g, 2800 Nickel slurry in water) and the reaction vessel was pressurized to 40 psi (0.28 MPa) with hydrogen overnight at room temperature. The resulting mixture was filtered through a pad of Celite® and washed with EtOAc. The filtrate was concentrated in vacuo and the residue added water (1 mL), followed by conc HCl at pH 1. The heterogeneous mixture was lyophilized to provide the title compound (130 mg, quantitative) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 9.14 (br.s., 1H), 8.36 (br.s., 3H), 7.49 (d, J=8.2Hz, 1H), 6.99 (d , J=8.2Hz, 1H), 5.40 (d, J=7.0Hz, 1H), 4.40 (br.s., 1H), 4.10 (br.s., 2H), 3.59 (br.s., 2H), 3.59 (br.s., 1H). ., 2H), ~3.30 (hidden, 1H), 2.89 (br.s., 1H), 1.89 (br.s, 2H); MS (ESI) m/z = 272 (M+1, positive); HPLC purity: 96.92% (MaxPlot 200 at 400 nm), 97.96% (220 nm). C. 3-Aminomethyl-7-ethoxy-4-fluoro)r-3H-benzoyl)lc]-11,2]-oxaborol-1-ol; 6-Fluoro-2,3-dimethoxy-benzaldehyde hydrochloride

To a cooled (-78 °C) solution of 4-fluoro-1,2-dimethoxybenzene (15.00 g, 96.05 mmols) in anhydrous THF (150 mL) was added n-BuLi (84.5 mL, 211.32 mmols, 2.5 M solution in hexanes) under nitrogen and stirred for 3 h at -78°C. The reaction was quenched with DMF (75 mL) at -65°C, 2N HCl (300 mL) was added dropwise and further stirred for 30 min. Separation of two layers was observed. The aqueous layer was extracted with EtOAc. The combined organic layers were washed with water, brine and dried over MgSO4. The ethyl acetate layer is filtered and concentrated in vacuo. The title compound was purified by flash column chromatography using pure hexanes, then 10% and 20% EtOAc in hexanes which provided 14.40 g (78.19 mmol, 82%) of the title compound as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 10.23 (s, 1H), 7.36 (dd, J=9.0, 5.1Hz, 1H), 7.03 (t, J=9.6Hz, 1H), 3.87 ( s, 3H), 3.83 (s, 3H); 19F NMR (376 MHz, DMSO-d6) □ ppm -131.68 - -131.66 (m, 1F). 6-Fluoro-2,3-dihydroxy-benzaldehyde

To a cooled (-78 °C) solution of 6-Fluoro-2,3-dimethoxy-benzaldehyde (4.50 g, 24.43 mmols) in anhydrous dichloromethane (30 mL) was added BBr3 (1M in DCM, 48.8 mL, 48.87 mmols) dropwise (30 min duration). The reaction was warmed to room temperature and stirred for 4 h. Again cooled to -78°C and 2N HCl (60 ml) added thereto dropwise. The reaction was stirred overnight at room temperature and extracted with DCM. The combined organic layers were washed with water, saturated NaHCO3 solution, brine and dried over MgSO4. Filtration and removal of solvent provided 2.42 g (15.50 mmols, 64%) of the title compound as a yellow solid. This was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) δ ppm 10.22 (s, 1H), 7.04 (dd, J=8.6, 5.5Hz, 1H), 6.61 (dd, J=10.4, 8.8Hz, 1H); 19F NMR (376 MHz, DMSO-d6) δppm -131.69--131.65 (m, 1F). 3-Ethoxy-6-fluor-2-hydroxy-benzaldehyde

To a solution of 6-fluoro-2,3-dihydroxy-benzaldehyde (1.00 g, 6.40 mmols) in dry DMSO (10 mL) was added NaOBut (1.23 g, 12.81 mmols) and ethyl bromide (0.77 g, 7.04 mmols) under N2 and stirred at room temperature for 18 h. The resulting mixture was diluted with water, acidified to pH ~6 with 2N.HCl and extracted with EtOAc (4x25 mL). The combined organic layers were washed with water and brine and dried over MgSO4. Filtration and removal of solvent under reduced pressure provided 1.05 g (5.70 mmols, 89%) of the title compound as a yellow solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.24 (s, 1H), 7.04 (dd, J=8.8, 5.3Hz, 1H), 6.61 - 6.50 (m, 1H), 4.09 (q, J =7.0Hz, 3H), 1.46 (t, J=7.0Hz, 3H); 19F NMR (376 MHz, CHLOROFORM-d) δppm -132.19-132.15 (m, 1F). Trifluoromethanesulfonic acid 6-ethoxy-3-fluoro-2-formyl-phenyl ester

To a cooled (0°C) solution of 3-ethoxy-6-fluoro-2-hydroxy-benzaldehyde (1.05 g, 5.70 mmols) in dry DCM (90 ml) was added pyridine (675 mg). , 8.53 mmols) under nitrogen and stirred at 0°C for 10 min. Then added triflic anhydride (1.93 g, 6.84 mmols) slowly and continuing to stir for 3 h at room temperature. The reaction is diluted with 1N.HCl (25 mL) and extracted with DCM (2x 100 mL). The organic layer was washed with water and brine and dried over MgSO4. The filtrate is filtered and concentrated. Purification of the residue by flash column chromatography with 5% ethyl acetate in hexanes provided 1.12 g, (3.54 mmols, 62%) of the title compound as a white solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.34 (s, 1H), 7.31 - 7.13 (m, 2H), 4.13 (q, J=7.0Hz, 2H), 1.48 (t, J=7.0 Hz, 3H); 19F NMR (376 MHz, CHLOROFORM-d) δ ppm -128.15- -128.11 (m, 1F), -73.56 (s, 3F). 3-Ethoxy-6-fluor-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde

[00263] [0009] A solution of trifluoro-methanesulfonic acid 6-ethoxy-3-fluoro-2-formyl-phenyl ester (1.60 g, 5.05 mmols) in anhydrous THF (50 mL) was degassed for 40 min. Bis(pinacolato)diboron (3.85 g, 15.17 mmols), KOAc (1.50 g, 15.17 mmols) and PdCl2(dppf) (296 mg, 8% by mol) were added and stirred. the reaction at 70°C (bath temperature) for 3 h. Another addition of bis(pinacolato)diboron (1.40 g, 5.51 mmols) and heating at 70 °C for 2 h completed the reaction. The resulting mixture was cooled to room temperature and filtered through a pad of Celite®. The filtrate was concentrated. Purification of the residue by flash column chromatography with hexanes and 5% EtOAc/hexanes yielded 1.65 g of the title compound as a white solid. 1H NMR confirms the presence of the title compound but with some impurities. This was used in the next step without further purification. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.29 (s, 1H), 7.12 - 6.97 (m, 2H), 4.00 (q, J=7.0Hz, 2H), 1.46 (s, 12H) , 1.41 (t, J=6.8 Hz, 3H); 19F NMR (376 MHz, CHLOROFORM-d) δ ppm - 133.71--133.67 (m, 1F). 7-Ethoxy-4-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol

[00264] 3-Ethoxy-6-fluor-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde (1.65 g, 5.61 mmols) was added to a solution of NaOH (225 mg, 5.60 mmols) in H2O (10 mL) and stirred for 10 min at room temperature. Nitromethane (1.03 g, 16.83 mmols) was added dropwise and stirred for 4 h at room temperature. The reaction mixture was acidified with 4N HCl and extracted with ethyl acetate. The organic layer was washed with water, brine and dried over MgSO4, filtered and concentrated in vacuo. Purification of the residue by flash column chromatography with 10 to 40% EtOAc/hexanes provided 1.7 g of a mixture of compounds by 1 H NMR spectrum. This mixture was used in the next step without further purification. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.13 (t, J=8.8 Hz, 1H), 6.79 (dd, J=8.8, 2.5Hz, 1H), 5.95 (d, J=9.0Hz, 1 H), 5.14 (s, 1H), 5.01 (dd, J=13.3, 2.3Hz, 1H), 4.44 (dd, J=13.3, 9.0Hz, 1H), 4.10 (q, J=6.8Hz, 2H), 1.45 (t, J=6.8Hz, 3H); 19F NMR (376 MHz, CHLOROFORM-d) δ ppm -131.00- -130.97 (m, 1F). 7-Ethoxy-4-fluoro-1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaborol-3-ylmethyl)-carbamic acid tert-butyl ester

[00265] To a cooled (at 0°C) solution of 7-ethoxy-4-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (500mg, 1.96mmol) in dry MeOH (20 mL) was added (Boc) 2 O (856 mg, 3.92 mmols) followed by NiCl 2 . 6H2O (466 mg, 1.96 mmol) under nitrogen. The reaction mixture was stirred under nitrogen for 20 min and NaBH4 (445 mg, 11.76 mmols) was added in portions and left overnight at room temperature. The solvent was evaporated and the reaction was diluted with 30 ml of ethyl acetate and filtered through Celite. The filtrate was concentrated and the residue was purified by flash column chromatography using 5% MeOH/DCM, but a mixture (950 mg) of the products was obtained which was used in the next step without further purification. 3-Aminomethyl-7-ethoxy-4-fluoro-3H-benzo[c][1,2]oxaborol-1-ol; hydrochloride

[00266] A solution of 7-ethoxy-4-fluoro-1-hydroxy-1,3-dihydro-benzo[c][1,2]oxaborol-3-ylmethyl)-carbamic acid tert-butyl ester (450 mg, 1.38 mmol) in 4M HCl (in 1,4-dioxane, 15 mL) was stirred at room temperature overnight. The solvent was removed under reduced pressure. Recrystallization from EtOAc/hexanes provided 245 mg (0.93 mmol, 62%) of the title compound as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 9.15 (br.s., 1H), 8.20 (br.s., 3H), 7.26 (t, J=9.0Hz, 1H), 6.95 - 6.85 (m, 1H), 5.45 (d, J=6.3Hz, 1H), 3.30 (hidden, 1H), 4.05 (q, J=6.9Hz, 2H), 2.89 (br.s., 1H) , 1.30 (t, J=6.8 Hz, 3H); 19F NMR (376 MHz, DMSO-d6) δppm -131.68--131.66 (m, 1F); MS (ESI) m/z = 226 (M+1, positive); HPLC purity: 91.87% (MaxPlot 200 at 400 nm), 90.33% (220 nm); Anal. Calcd for C10H14BClFNO3.0.5 H2O: C 44.40%; H 5.59%; N 5.18%. Discovery: C 44.30%; H 5.42%; N 5.50%. D. 3-(Aiminomethyl)-4-chloro-7-ethoxybenz.o[c][1,2]oxaborol-1(3H)-ol 2-Bromo-3-hydroxybenzaldehyde

[00267] Suspension of 3-hydroxybenzaldehyde (5 g, 0.04 mol), iron powder (172 mg, 3 mmols) and sodium acetate (6.72 g, 0.08 mol) in acetic acid (40 mL) ) was heated until a clear solution was obtained and then cooled to room temperature. To this mixture a solution of bromine in glacial acetic acid (10 ml) was added dropwise over 15 min. After addition, the reaction mixture was stirred for 2 h and then poured into ice water. The resulting mixture was extracted with dichloromethane (3x50ml). The combined extracts were dried over anhydrous Na2SO4 and concentrated. The residue was recrystallized from dichloromethane to provide the product (2.3 g, 28% yield). 1H NMR (400 MHz, DMSO-d6 δ 10.30 (s, 1H), 7.54-7.51 (m, 1H), 7.39-7.35 (m, 1H), 7.31-7.27 (m, 1H), 5.90 (s, 1H) ). 2-Bromo-3-ethoxybenzaldehyde

[00268] Suspension of 2-bromo-3-hydroxybenzaldehyde (120 g, 0.60 mol), K2CO3 (247 g, 1.79 mol) and bromoethane (135 ml, 1.79 mol) in DMF (700 ml) was stirred at 70oC for 3 h. After the reaction was quenched with water (50 mL), the resulting mixture was extracted with EtOAc (3x60 mL). The organic layers were washed with water solution (50 ml) and aqueous LiCl (50 ml), dried over anhydrous Na 2 SO 4 and concentrated to dryness in vacuo. The residue was purified by silica gel column chromatography to provide the target compound (128 g, 94%) yield. 1H NMR (400 MHz, DMSO-d6 δ 10.45 (s, 1H), 7.52-7.50 (d, 1H), 7.38-7.34 (t, 1H), 7137.10 (d, 1H), 4.18-4.13 (m, 1H), 2H), 1.53-1.50 (m, 3H) 2-(2-Bromo-3-ethoxyphenyl)-1,3-dioxolane

[00269] To a solution of 2-bromo-3-ethoxybenzaldehyde (128 g, 0.56 mol) and glycol (253 mL, 4.49 mol) in toluene (600 mL) was added p-toluenesulfonic acid (10 g, 0.06 mol). The reaction flask had a Dean-Stark condenser attached and the reaction mixture was refluxed to remove water for 4 h. The reaction mixture was then cooled to room temperature and concentrated in vacuo. The residue was purified by silica gel column chromatography to provide the target compound (132 g, 86% yield). Diisopropyl 2-(1,3-dioxolan-2-yl)-6-ethoxyphenylboronate

To a solution of 2-(2-bromo-3-ethoxyphenyl)-1,3-dioxolane (132 g, 0.48 mol) in anhydrous THF (500 mL) was added dropwise n-BuLi (at 2 .5M in THF, 386 mL, 0.97 mol) at -78°C under nitrogen protection. The mixture was stirred at -78°C for 2 h, then triisopropyl borate (227 mL, 0.97 mol) was added dropwise. The resulting mixture was stirred at this temperature for 4 h. After the reaction was quenched by addition of saturated aqueous NH4Cl solution (200 mL), the resulting mixture was extracted with EtOAc (3x300 mL). The organic layers were washed with water (200 ml) and brine (200 ml), dried over anhydrous Na 2 SO 4 and concentrated to dryness. The residue was purified by silica gel column chromatography to provide the target compound (136 g, 87% yield). 2-Ethoxy-6-formylphenylboronic acid

To the mixture of diisopropyl 2-(1,3-dioxolan-2-yl)-6-ethoxyphenylboronate (136 g, 0.42 mol) in THF (500 mL) was added dilute HCl (2N, 200 ml) slowly at room temperature with stirring. After being stirred for 1.5 h at room temperature, the reaction mixture was basified with 20% aqueous NaOH solution at pH=12 and then washed with EtOAc (2x100 mL). The aqueous layer was acidified using dilute HCl (2N) to pH=2 and then extracted with EtOAc (3x100 mL). The combined organic layers were dried over anhydrous Na2SO4 and concentrated to dryness. The residue was purified by silica gel column chromatography to provide the target compound as a white solid (80 g, 83% yield). 1H NMR (400 MHz, DMSO-d) δ 9.93 (s, 1H), 7.92 (s, 2H), 7.45-7.48 (m, 2H), 7.23-7.28 (d, 1H), 4.01-4.06 (m, 2H) ), 1.69-1.20 (m, 3H). 7-Ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol

[00272] A mixture of 2-ethoxy-6-formylphenylboronic acid (80 g, 0.41 mol), NaOH (16.5 g, 0.41 mol) and CTAB (7.7 g, 20 mmols) in H2O ( 100 ml) and THF (500 ml) was stirred for 0.5 h at room temperature. After dropwise addition of nitromethane (14 mL, 2.4 mols), the reaction mixture was stirred at room temperature for 3 h. Then, cyclization was provided by the addition of dilute HCl (2N) to pH=2 and then extracted with EtOAc (3x300 mL). The organic layers were washed with brine (250 mL), dried over anhydrous Na 2 SO 4 and concentrated to dryness in vacuo. The residue was purified by silica gel column chromatography to provide the target compound as a white solid (92 g, 94%) yield. 1H NMR (400 MHz, DMSO-d6 δ 9.06 (s, 1H), 7.46-7.43 (t, 1H), 7,077.05 (d, 1H), 6.89-6.87 (d, 1H), 5.71-5.69 (m, 1H), 1H), 5.31-5.27 (m, 1H), 4.574.51 (m, 1H), 4.12-4.07 (m, 2H), 1.34-1.30 (t, 3H). nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol

[00273] To a solution of 7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (42 g, 0.18 mol) in DMF (200 mL) at 80°C a solution of NCS (11.8 g, 0.18 mol) in DMF (50 ml) was added in 30 min. The reaction was quenched with an aqueous LiCl solution (500 mL) and the resulting mixture was extracted by EtOAc (3x250 mL). The combined organic layers were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by silica gel column chromatography to provide the compound as a white solid. (39.7 g, contaminated with 18% C6-C1 regioisomer). The mixture was then recrystallized Ether/PE (1/5) to provide the pure compound (28 g, 46.3% yield). 1H NMR (400 MHz, DMSO-d6) δDD 9.32 (s, 1H), 7.50-7.48 (d, 1H), 6.98-6.96 (d, 1H), 5.77-5.74 (d, 1H), 5.35-5.31 (d, 1H) , 1H), 4.73-4.67 (m, 1H), 4.12-4.07 (m, 2H), 1.34-1.28 (t, 3H). 3-(Aminomethyl)-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride

[00274] A mixture of 4-chloro-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (47 g, 0.17 mol), Raney Ni (2 g) and 2M NH3 in EtOH (40 mL) in EtOH (200 mL) was stirred under an atmosphere of H2 for 2 h and then filtered. The filtrate was acidified using 4.5N HCl in EtOH (100 mL). After stirring for 30 min, the mixture was concentrated and the residue was washed with CH 3 CN (2x50 mL) to provide the product as a white solid (43 g, 89% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.13 (s, 1H), 8.18 (s, 3H), 7.50-7.51 (d, 1H), 6.97-7.00 (d, 1H), 5.36-5.39 (m, 1H), 4.08-4.14 (m, 2H), 3.55-3.59 (m, 1H), 2.90-2.95 (m, 1H), 1.33-1.36 (m, 3H); MS (ESI) m/z = 242 [M + H]+. E. 3-(Ammomethyl)-4-bromo-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol 2,2,2-trifluoroacetate salt 3-(Aminomethyl) hydrochloride salt -7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol

[00275] To a solution of 7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (2 g, 8.43 mmols), Raney Ni (200 mg) and NH3 2M in EtOH (10 mL) in ethanol (35 mL) was stirred under an atmosphere of H2 for 2 h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The crude amine was dissolved in EtOAc (10 mL) and HCl in Et2O (30 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid was washed with acetonitrile/hexanes (2:1, 2x20 mL) to provide the compound as a white solid (1 g, 57.2% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.89 (s, 1H), 8.22 (s, 3H), 7.48-7.44 (t, 1H), 7.06-7.04 (d, 1H), 6.90-6.88 (d, 1H) ), 5.31-5.29 (m, 1H), 4.13-4.08 (m, 2H), 3.45-3.39 (m, 1H), 2.80-2.78 (m, 1H), 1.36-1.33 (m, 3H); MS (ESI) m/z = 208 [M + H]+. tert-Butyl(7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl carbamate

[00276] To a mixture of 3-(aminomethyl)-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride salt (300 mg, 1.23 mmol) and triethylamine (622 mg, 6.16 mmols) in dichloromethane (35 mL) at 0°C was added di-tert-butyl dicarbonate (402.8 mg, 1.85 mmol) and the mixture was stirred for 2 h at room temperature. After the reaction was quenched with sat. (45 mL) and the resulting mixture extracted with EtOAc (3x30 mL), the combined organic layers were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by flash column chromatography to provide the product (320 mg, 84.6% yield). tert-butyl (4-bromo-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)-methylcarbamate

[00277] To tert-butyl (7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl-carbamate solution (250 mg, 0.81) mmol) and 1-bromopyrrolidine-2,5-dione (173.9 mg, 0.98 mmol) in CH3CN (50 mL) was added 2,2'-Azobis(2-methylpropionitrile (10 mg) and the mixture was stirred for 1 h at 90°C. The reaction mixture was then concentrated under high vacuum and the residue was purified by preparative HPLC to provide the product (200 mg, 63.6% yield).1H NMR (400 MHz, DMSO-d6) δ 8.90 (s, 1H), 7.55-7.53 (d, 1H), 6.85-6.82 (d, 1H), 5.08-5.07 (d, 1H), 4.114.07 (m, 2H), 3.82-3.79 (d, 1H), 3.06-3.03 (m, 1H), 1.39 (s, 9H), 1.30 (t, 3H); MS (ESI) m/z = 387 [M + H]+. 3-(Aminomethyl)-4-bromo-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol trifluoro-acetate

[00278] A mixture of tert-butyl (4-bromo-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)-methylcarbamate (200 mg, 51.8 mmol) in 2,2,2-trifluoroacetic acid and dichloromethane (1:1, 20 mL) was stirred at room temperature for 1 h and concentrated to dryness (water bath < 30°C). The residue was washed with acetonitrile (2x5ml) and the white solid was dried under high vacuum to provide the product (190mg, 91.6% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.12 (s, 1H), 8.04 (s, 3H), 7.65-7.62 (d, 1H), 6.94-6.92 (d, 1H), 5.27-5.25 (m, 1H) ), 4.13-4.08 (m, 2H), 3.64-3.61 (m, 1H), 2.99-2.92 (m, 1H), 1.36-1.33 (t, 3H); MS (ESI) m/z = 287 [M + H]+. F. 3-(Aminomethyl)-7-ethoxy-4-methylbenzo[c][1,2]oxaborol-1(3H)-ol 7-Ethoxy-4-methyl-3-(nitromethyl)benzo[c] hydrochloride salt c][1,2]oxaborol-1(3H)-ol

[00279] [0010] A mixture of 4-bromo-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (200 mg, 0.63 mmol), tetramethylstannane (341.7 mg, 1.90 mmol) and Pd(PPh3)4 (Cat. 20 mg) in DMF (35 mL) was stirred overnight at 90°C under N2 protection. The reaction was quenched by adding ice water and the resulting mixture was extracted with ethyl acetate (3x30ml). The combined extracts were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by prep-TLC to provide the product (72 mg, 45.3% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.00 (s, 1H), 7.23-7.21 (d, 1H), 6.83-6.81 (d, 1H), 5.77-5.75 (m, 1H), 5.27-5.24 (m) , 1H), 4.50-4.44 (m, 1H), 4.08-4.03 (m, 2H), 2.25 (s, 3H), 1.33-1.29 (t, 3H). 3-(Aminomethyl)-7-ethoxy-4-methylbenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride salt

[00280] A mixture of 7-ethoxy-4-methyl-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (80 mg, 0.32 mmol), Raney Ni (50 mg) and NH3/EtOH (2 mL) in EtOH (10 mL) was stirred under an atmosphere of H2 for 2 h and then filtered. The filtrate was acidified using 4.5N HCl in EtOH (15ml). After stirring for 30 min, the mixture was concentrated in vacuo and the residue washed with CH 3 CN (2x3 mL) to provide the product as a white solid (39 mg, 47.5% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.80 (s, 1H), 8.15 (s, 3H), 7.24-7.22 (d, 1H), 6.83-6.81 (d, 1H), 5.37-5.35 (m, 1H) ), 4.08-4.03 (m, 2H), 3.36-3.28 (m, 1H), 2.73-2.70 (m, 1H), 2.23 (s, 3H), 1.341.30 (t, 3H); MS (ESI) m/z = 222 [M + H]+. G. 3-(Aiminomethyl)-7-ethoxy-4-ethylbenzo[c][1,2]oxaborol-1(3H)-ol 7-Ethoxy-3-(nitromethyl)-4-vinylbenzo[c][1, 2]oxaborol-1(3H)-ol

[00281] A mixture of 4-bromo-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (900 mg, 2.85 mmols), vinyltributyltin (5, 2 g, 53 mmols) and Pd(Ph3P)4 (230 mg, 0.2 mmol) in DMF (45 mL) was degassed for 15 min with N2 and then stirred at 100°C for 30 min in a reactor microwave oven (Biotage). After the reaction was quenched with ice water, the resulting mixture was extracted with EtOAc (3x30 mL). The organic layers were washed with water (20ml) and brine (20ml), dried over anhydrous Na 2 SO 4 and then concentrated to dryness in vacuo. The residue was purified by silica gel column chromatography to provide the compound (650 mg, 87% yield). 1H NMR (400 MHz, DMSO-d6 □ □ δ 9.10 (s, 1H), 7.64-7.66 (d, 1H), 6.93-6.95 (d, 1H), 6.77-6.84 (m, 1H), 5.93-5.96 (d, 1H), 5.69-5.73 (d, 1H), 5.28-5.31 (d, 1H), 5.10-5.14 (d, 1H), 4.44-4.49 (m, 1H), 4.09-4.14 (m, 2H) , 1.32-1.35 (m, 3H); MS (ESI) m/z = 264 [M + H]+. 3-(Aminomethyl)-7-ethoxy-4-vinylbenzo[c][1,2]oxaborol-1 (3H)-ol

[00282] A mixture of 7-ethoxy-3-(nitromethyl)-4-vinylbenzo[c][1,2]oxaborol-1(3H)-ol (205 mg, 0.78 mmol), Raney-Ni (50 mg) and 2M NH3 in EtOH (5 mL) in EtOH (10 mL) was stirred under an atmosphere of H2 for 2 h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The crude amine was dissolved in EtOAc (2 mL) and HCl in Et2O (20 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid was used directly for the next step without further purification. 3-(Aminomethyl)-7-ethoxy-4-ethylbenzo[c][1,2]oxaborol-1(3H)-ol

[00283] To a suspension of 3-(aminomethyl)-7-ethoxy-4-vinylbenzo[c][1,2]oxaborol-1(3H)-ol (175 mg, 0.75 mmol) with Pd/C ( 40 mg) in EtOH (5 ml) was stirred under an atmosphere of H2 for 2 h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The crude amine was dissolved in EtOAc (2 mL) and HCl in Et2O (15 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid washed with hexanes to provide the target compound (23 mg, 13% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.81 (s, 1H), 8.18 (s, 3H), 7.31-7.29 (d, 1H), 6.68-6.88 (d, 1H), 5.38-5.40 (d, 1H), 1H), 4,044.09 (d, 2H), 3.30-3.35 (m, 1H), 2.66-2.71 (m, 1H), 1.31-1.34 (m, 3H), 1.151.17 (m, 3H); MS (ESI) m/z = 236 [M + H]+. H. 3-(Aminomethyl)-7-ethoxy-4-phenylbenz.olcb1,2]oxaborol-1(3H)-ol 7-Ethoxy-3-(nitromethyl)-4-phenylbenzo[c][1,2]oxaborol -1(3H)-ol

[00284] A mixture of 4-bromo-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (315 mg, 1 mmol), tributyl-phenyl-stannane ( 750 mg, 2 mmols) and Pd(Ph3P)4 (Cat.) in DMF (15 mL) was degassed for 15 min with N2 and then stirred at 100°C for 30 min in microwave reactor (Biotage). After the reaction was quenched with ice water, the resulting mixture was extracted with EtOAc (3x40 mL). The organic layers were washed with water (20ml) and brine (20ml), dried over anhydrous Na 2 SO 4 and then concentrated to dryness. The residue was purified by silica gel column chromatography to provide the compound as a white solid (60 mg, 20% yield). 1HNMR (400 MHz, DMSO-d6□ □ ) δ 9.13 (s, 1H), 7.46-7.49 (m, 5H), 7.34-7.48 (m, 2H), 6.17-6.20 (m, 1H), 4.88-4.92 (m, 1H), 4.21-4.25 (m, 1H), 4.05-4.16 (m, 2H), 1.34-1.37 (m, 3H). 3-(Amin(methyl)-7-ethoxy-4-phenylbenz([c][1,2](xab(r(1-1(3H))-(1

[00285] A mixture of 7-ethoxy-3-(nitromethyl)-4-phenylbenzo[c][1,2]oxaborol-1(3H)-ol (60 mg, 0.19 mmol), Raney-Ni (~ 25mg) and 2M NH3 in EtOH (2ml) in EtOH (10ml) was stirred under an atmosphere of H2 for 2h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The crude amine was dissolved in EtOAc (1 mL) and HCl in Et2O (5 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid washed with hexanes to provide the compound as a white solid (30 mg, 51% yield). 1 HNMR (400 MHz, DMSO-d6) δ 8.89 (s, 1H), 8.04 (s, 3H), 7.43-7.46 (d, 5H), 7.36-7.38 (d, 1H), 6.98-7.00 (d, 1H) ), 5.78-5.81 (d, 1H), 4.09-4.14 (m, 2H), 2.56-2.59 (m, 1H), 2.24-2.30 (m, 1H), 1.33-1.36 (m, 3H); MS (ESI) m/z = 284 [M + H]+. I. 7-(4-Aminobutoxy)-3-(aminomethyl)-4-chlorobenzo[c][1,2]oxaborol-1(3H)-ol tert-butyl 4-hydroxybutylcarbamate dihydrochloride

[00286] To a mixture of 4-aminobutan-1-ol (4.0 g, 45 mmols) and TEA (7.5 mL, 54 mmols) in DCM (200 mL) was added (Boc)2O (10.2 g, 47.2 mmols). The reaction mixture was stirred for 2 h at room temperature and then washed with water (2x150 mL) and citric acid solution (100 mL). The organic layer was dried over anhydrous Na 2 SO 4 and concentrated to provide the product as a yellow oil 7.5 g. (yield 88%). 4-(tert-Butoxycarbonyl)butyl methanesulfonate

To a mixture of tert-butyl 4-hydroxybutylcarbamate (7.5 g, 40 mmol) and TEA (3.6 mL, 48 mmol) in DCM (100 mL) at 0°C was added dropwise MsCl (6, 6 ml, 48 mmols). The mixture was stirred at room temperature for 1 h, then washed with water (2x100 ml) and citric acid solution (100 ml). The organic layer was dried over anhydrous Na 2 SO 4 and concentrated to provide the product as a yellow oil (10.0 g, 94%) yield. tert-Butyl 4-(2-bromo-3-formylphenoxy)butylcarbamate

To a mixture of 2-bromo-3-hydroxybenzaldehyde (3.0 g, 15 mmols) and tert-butoxycarbonyl)butyl methanesulfonate (4.8 g, 18 mmols) in DMF (40 mL) was added K2CO3 ( 6.2 g, 45 mmols). The mixture was stirred at 80°C for 45 min and quenched by aqueous LiCl solution (80 ml). The mixture was extracted with EtOAc (2x80 mL) and the combined organic layers were dried over anhydrous Na 2 SO 4 then concentrated to provide the crude product as a brown oil (6.0 g). tert-Butyl 4-(3-formyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)-butylcarbamate

[00289] A mixture of tert-butyl 4-(2-bromo-3-formylphenoxy)butylcarbamate (6.0 g, 16 mmols), KOAc (5.0 g, 48 mmols), (Pin)2B2 (7.7 g, 86 mmols) and Pb(dppf)Cl2 (1.25 g, 1.6 mmols) in dioxane (100 mL) was degassed for 15 min with N2 and refluxed for 2 h under N2 protection. The mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by silica gel chromatography to provide the product as a yellow oil (3.5 g, 55% yield). tert-Butyl-4-(1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxa-borol-7-yloxy)butylcarbamate

To a solution of tert-butyl 4-(3-formyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-phenoxy)-butylcarbamate (3 .5 g, 8.3 mmols) and CTAB (cat.) in THF (50 mL) was added MeNO2 (2.8 mL, 49 mmol), followed by an aqueous NaOH solution (0.36 g, 9.1 mmols) in H2O (5 mL). The mixture was stirred at room temperature for 45 min. Cyclization was provided by addition of a 2N HCl solution until pH=2 at 0°C. The reaction mixture was extracted with EtOAc (3x50 mL) and the organic layers were dried over anhydrous Na2SO4, and then concentrated in vacuo. The residue was purified by silica gel chromatography (PE: EtOAc=3:1) to provide the product as yellow oil (1.7 g, 53.6% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.05 (s, 1H), 7.447.47 (t, 1H), 7.06-7.08 (d, 1H), 6.88-6.90 (d, 1H), 9.86 (t, 1H) ), 5.70-5.72 (m, 1H), 5.29-5.33 (m, 1H), 4.53-4.59 (m, 1H), 4.02-4.06 (t, 2H), 2.95-2.30 (m, 2H), 1.67-1.72 (m, 2H), 1.52-1.57 (m, 2H), 1.38 (s, 9H). tert-Butyl-4-(4-chloro-1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yloxy)butylcarbamate

[00291] To a mixture of tert-butyl 4-(1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yloxy)-butylcarbamate (640 mg , 1.7 mmol) in DMF (20 mL) was added NCS (226 mg, 1.7 mmol) in DMF (5 mL). The mixture was heated at 80°C for 2 h. After the reaction was quenched with an aqueous LiCl solution (100 mL), the resulting mixture was extracted with EtOAc (3x50 mL). The combined organic layers were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by preparative HPLC to provide the product (280 mg, 67.5% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.29 (s, 1H), 7.47-7.49 (d, 1H), 6.96-6.98 (d, 1H), 6.80 (s, 1H), 5.74-5.77 (m, 1H) ), 5.31-5.35 (m, 1H), 4.674.72 (m, 1H), 4.02-4.05 (m, 2H), 2.94-2.99 (m, 2H), 1.68-1.72 (m, 2H), 1.501.56 (m, 2H), 1.36 (s, 9H). tert-butyl 4-(3-(aminomethyl)-4-chloro-1-hydroxy-1,3-dihydro-benzo[c][1,2]oxa-borol-7-yloxy)butylcarbamate

[00292] A mixture of tert-butyl 4-(1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yl-oxy)-butylcarbamate (410 mg, 1 mmol), Raney-Ni (100 mg) and 2N NH3 in EtOH (3 mL) in EtOH (15 mL) was stirred under an atmosphere of H2 for 2 h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The resulting solid was used directly for the next step. 7-(4-Aminobutoxy)-3-(aminomethyl)-4-chlorobenzo[c][1,2]oxaborol-1(3H)-ol dihydrochloride

[00293] To a mixture of tert-butyl-4-(3-(aminomethyl)-4-chloro-1-hydroxy-1,3-dihydrobenzo[c]-[1,2]-oxa-borol-7 Crude -yloxy)butylcarbamate in DCM (5 mL) was added CF 3 COOH (2 mL) at room temperature. The reaction mixture was stirred for 1 h and concentrated in vacuo. The crude amine was dissolved in EtOAc (1 mL) and HCl in Et2O (10 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid was washed with hexanes to give the target compound as white solid (180 mg, yield: 42%). 1H NMR (400 MHz, DMSO-d6) δ 9.16 (s, 1H), 8.28 (s, 3H), 8.03 (d, 3H), 7.49-7.51 (d, 1H), 6.99-7.01 (d, 1H), 5385.40 (m, 1H), 4.05-4.08 (m, 2H), 3.56-3.59 (d,1H), 2.84-2.91 (m,3H), 1711.83 (m, 4H); MS (ESI) m/z =285 [M + H]+. J. 3-(Ammomethyl)-7-(3-ammopropoxy)-4-chlorobenzo[c][1,2]oxaborol-1(3H)-ol tert-butyl 3-bromopropylcarbamate

[00294] To a mixture of 3-bromopropan-1-amine (10.95 g, 50 mmols) and TEA (15.4 ml, 110 mmols) in DCM (100 ml) at 0°C was added (Boc)2O (11.4 g, 52.5 mmols). The reaction mixture was stirred at room temperature overnight and then washed with water (3x100ml) and citric acid solution (100ml). The organic layer was dried over anhydrous Na 2 SO 4 and concentrated to provide the product as a yellow oil (9.0 g, 76% yield). tert-Butyl 3-(2-bromo-3-formylphenoxy)propylcarbamate

[00295] A mixture of 2-bromo-3-hydroxybenzaldehyde (5 g, 24.9 mmols), 3-(tert-butoxycarbonylamino)-propyl methanesulfonate (7.55 g, 30 mmols) and Cs2CO3 (24 g, 75 mmols) in DMF (60 mL) was stirred at 50°C for 3 h and quenched with water (600 mL). The resulting mixture was extracted with EtOAc (3x60 mL) and the combined organic layers were washed with brine (60 mL), dried over anhydrous Na 2 SO 4 and concentrated in vacuo. The residue was purified by silica gel column chromatography (PE/EtOAc=10/1) to provide the product (7.2 g, 81% yield). 1H NMR (400 MHz, CDCl3) δ 10.43 (s, 1H), 7.53 (dd, J=7.8 Hz, 1.6 Hz, 1H), 7.37 (t, J=7.8 Hz, 1H), 7.12 (dd, J=8.2 Hz, 1.6Hz, 1H), 5.16 (s, 1H), 4.15 (t, J=5.9Hz, 2H), 3.42 (m, 2H), 2.10 (m, 2H), 1.44 (s, 9H); MS (ESI) m/z =358 [M+H]+. tert-Butyl 3-(3-formyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-phenoxy)propylcarbamate

A solution of tert-butyl 3-(2-bromo-3-formylphenoxy)propylcarbamate (7.1 g, 20 mmols), B2pin2 (10 g, 40 mmols), Pd(dppf)Cl2 (800 mg, 2 mmols) and KOAc (5.9 g, 60 mmols) in 1,4-dioxane (30 mL) was degassed with N2 and stirred at 80 °C for 5 h. The mixture was cooled to room temperature and diluted with EtOAc (100 ml). The organic layer was washed with water (50 ml) and brine (50 ml), dried over anhydrous Na 2 SO 4 and then concentrated. The residue was purified by silica gel chromatography (PE/ EtOAc =5/1) to provide the product (3.1 g, 38.3% yield). 1H NMR (400 MHz, CDCl 3 ) δ 9.95 (s, 1H), 7.48 (t, J=7.8 Hz, 1H), 7.40 (m, 1H), 7.09 (d, J=8.2 Hz, 1H), 4.76 (s , 1H), 4.05 (t, J=6.3 Hz, 2H), 3.32 (m, 2H), 2.00 (m, 2H), 1.45 (s, 12H), 1.43 (s, 9H); MS (ESI) m/z =406 [M+H]+. tert-butyl 3-(1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yloxy)-propylcarbamate

[00297] A mixture of tert-butyl 3-(3-formyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)propylcarbamate (3.1 g , 8.47 mmols), MeNO2 (775 mg, 12.7 mmols), CTAB (310 mg, 0.85 mmol) and NaOH (407 mg, 10 mmols) in THF (35 mL) and H2O (8 mL) was stirred at room temperature for 3 h. The mixture was adjusted to pH 2 to 3 using 2N HCl and then stirred for 30 min. The mixture was extracted with EtOAc (2x80ml). The organic layer was washed with water (30 ml) and brine (30 ml), dried over anhydrous Na 2 SO 4 and then concentrated. The residue was purified by column chromatography on silica gel (PE/ EtOAc =5/1) to provide the product (2 g, 64.5% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.05 (s, 1H), 7.47 (t, J=7.8 Hz, 1H), 7.07 (d, J=7.4 Hz, 1H), 6.91 (m, 2H), 5.72 (dd, J=9.0, 2.7 Hz, 1H), 5.31 (dd, J=13.3.2.7 Hz, 1H), 4.54 (dd, J=13.3.9.4 Hz, 1H), 4.05 (t, J=6.3 Hz, 2H), 3.09 (m, 2H), 1.83 (m, 2H), 1.37 (s, 9H); MS (ESI) m/z =367 [M+H]+. tert-Butyl-4-(4-chloro-1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yloxy)propylcarbamate

[00298] To a mixture of tert-butyl 4-(1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yl-oxy)propylcarbamate (2 .9g, 8mmol) in DMF (35ml) was added NCS (1.0g, 8mmol) in DMF (15ml). The reaction mixture was heated to 80°C for 2 h, then quenched with an aqueous LiCl solution (300 mL). The resulting mixture was extracted with EtOAc (3x100ml). The combined organic layers were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by preparative HPLC to provide the product as a white solid (480 mg, 15.2% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.28 (s, 1H), 7.49-7.51 (d, 1H), 6.96-6.98 (d, 1H), 6.85 (s, 1H), 5.74-5.77 (m, 1H) ), 5.31-5.35 (m, 1H), 4.67-4.72 (m, 1H), 4.03-4.06 (m, 2H), 3.07-3.11 (m, 2H), 1.82-1.86 (m, 2H), 1.37 (s , 9H); MS (ESI) m/z = 401 [M + H]+. tert-Butyl 3-(3-(aminomethyl)-4-chloro-1-hydroxy-1,3-dihydro-benzo[c][1,2]oxa-borol-7-yloxy)propylcarbamate

[00299] A mixture of tert-butyl 3-(4-chloro-1-hydroxy-3-(nitromethyl)-1,3-dihydrobenzo[c][1,2]oxaborol-7-yloxy)propylcarbamate ( 480mg, 1.2mmol), Raney-Ni (500mg) and 2M NH3 in EtOH (3ml) in EtOH (15ml) was stirred under an atmosphere of H2 for 2h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The resulting solid was used directly for the next step. 3-(Aminomethyl)-7-(3-aminopropoxy)-4-chlorobenzo[c][1,2]oxaborol-1(3H)-ol

To a mixture of 3-(3-(aminomethyl)-4-chloro-1-hydroxy-1,3-dihydrobenzo[c]-[1,2]oxaborol-7-yloxy)propylcarbamate tert- crude butyl in DCM (10 mL) was added CF 3 COOH (2.0 mL) at 0°C. The reaction mixture was stirred for 1 h and concentrated in vacuo. The crude amine was dissolved in EtOH (2 mL) and HCl in Et2O (2 mL) was added immediately. After 1 h the mixture was concentrated in vacuo. The residue was recrystallized from EtOH/Et2O to provide the target compound (173.4 mg, 42% yield). 1H NMR (400 MHz, DMSO-d6) δ 9.28 (s, 1H), 8.36 (s, 3H), 8.17 (s, 3H), 7.50-7.52 (d, 1H), 6.98-7.00 (d, 1H), 5.39-5.42 (m, 1H), 4.13-4.16 (m, 2H), 3.56-3.59 (d, 1H), 2.98-2.99 (m, 2H), 2.87 (s, 1H), 2.04-2.10 (m, 2H) ); MS (ESI) m/z = 271 [M + H]+. K. (R)-3-(Aminomethyl)-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride and L. (S)-3-(Aminomethyl hydrochloride )-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol
tert-Butyl ((4-chloro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate

[00301] A solution of 3-(aminomethyl)-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride (38.4 g, 0.16 mol) and Et3N (47.8 g, 0.47 mol) in CH 2 Cl 2 (350 mL) at 0 °C was added di-tert-butyl dicarbonate (172 g, 0.79 mol) and the reaction was stirred for 2 h at room temperature . After the reaction was quenched by addition of sat. (100ml) and the resulting mixture was extracted with EtOAc (3x120ml). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The residue was purified by silica gel column chromatography to provide the compound as a white solid (27 g, 50% yield). 1H NMR (400 MHz, DMSO-d6) δ 8.92 (s, 1H), 7.40-7.42 (d, 1H), 6.88-6.90 (d, 1H), 6.776.79 (m, 1H), 5.15-5.16 ( d, 1H), 4.06-4.13 (m, 2H), 3.75-3.78 (d, 1H), 3.03-3.08 (m, 1H), 1.31-1.34 (m, 12H); MS (ESI) m/z = 286 [M + H]+. ((4-chloro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)(S)-tert-Butyl and ((4) (R)-tert-butyl -chloro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate
Enantiomer B Enantiomer A
[00302] 25.7 g of tert-butyl ((4-cl-hydroobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate dissolved in acetonitrile (10 mg/ml) were dissolved by means of Chiral HPLC using ChiralPak AD-H (250x30 mm ID) and SF CO2/methanol as eluent. The flow rate is 70mL/min. UV detection was monitored at 220 nm. Two peaks were collected and evaporated to yield 10.65 g of enantiomer A (faster eluting isomer) and 10.15 g of enantiomer B (slower eluting isomer). Analysis of pooled fractions using a ChiralPak AD-3 (150x4.6 mm ID) and the same mobile phase showed the A enantiomer with a retention time of 3.12 min and 98.7% ee, and the B enantiomer with a retention time 3.44 min and 98.5% ee (R)-3-(Aminomethyl)-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride

Enantiomer A (7.0 g, 20.5 mmol) was dissolved in 30 mL of dioxane and treated with 4M HCl (26.7 mL, 106.6 mmols) in dioxane. The reaction mixture was stirred at room temperature overnight until the reaction was complete indicated LC/MS. After dioxane was removed in vacuo and diethyl ether was added, an off-white solid was collected and dried under high vacuum. This material was taken up in acetonitrile and water (1:1, v/v) and lyophilized to provide 5.17 g of the title compound as an off-white solid. 1H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 8.22 (s, 3H), 7.47 (d, 1H), 6.95 (d, 1H), 5.34-5.37 (m, 1H), 4.06 -4.11 (m, 2H), 3.533.56 (m, 1H), 2.89 (m, 1H), 1.30-1.34 (m, 3H); MS (ESI) m/z = 242.0 [M + H]+. (S)-3-(Aminomethyl)-4-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride

Enantiomer B (7.0 g, 20.5 mmols) was dissolved in 30 mL of dioxane and treated with 4M HCl (26.7 mL, 106.6 mmols) in dioxane. The reaction mixture was stirred at room temperature overnight until the reaction was complete indicated by LC/MS. After dioxane was removed in vacuo and diethyl ether was added, an off-white solid was collected and dried under high vacuum. This material was taken up in acetonitrile and water (1:1, v/v) and lyophilized to provide 5.23 g of the title compound as an off-white solid. 1H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 8.25 (s, 3H), 7.47 (d, 1H), 6.95 (d, 1H), 5.35-5.38 (m, 1H), 4.06 -4.11 (m, 2H), 3.53-3.56 (m, 1H), 2.88 (m, 1H), 1.30-1.33 (m, 3H); MS (ESI) m/z = 242.0 [M + H]+. M. (R)-3-(Aminomethyl)-4-fluoro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride and N. (S)-3-(Aminomethyl hydrochloride )-4-fluoro-7-ethoxybenzo[c][1,2]oxaborol-
tert-Butyl ((4-fluoro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate

[00305] This compound was prepared from 3-aminomethyl-7-ethoxy-4-fluoro-3H-benzo[c][1,2]-oxaborol-1-ol hydrochloride using the similar procedure as described above. ((4-fluoro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)(S)-tert-Butyl and ((4) (R)-tert-butyl -fluoro-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate
Enantiomer B Enantiomer A
[00306] 4.5 g of tert-butyl ((4-flihydrobenzo[c][1,2]oxaborol-3-yl)methyl)carbamate dissolved in ethanol (100 mg/ml) were resolved by HPLC chiral using ChiralCel OZ-H column (250x30 mm ID) and SF CO2/hexane:ethanol(1:1) as eluent. The flow rate is 70mL/min. UV detection was monitored at 220 nm. Two peaks were collected and evaporated to provide 2.1 g of enantiomer A (faster eluting isomer) and 2.2 g of enantiomer B (slower eluting isomer). Analysis of pooled fractions using ChiralCel OZ-H (150x4.6 mm ID) and SF CO2/ethanol (0.05% DEA) as mobile phase showed enantiomer A with a retention time of 2.66 min and 99.5 % ee, and enantiomer B with a retention time of 3.31 min and 98.1% ee (R)-3-(Aminomethyl)-4-fluoro-7-ethoxybenzo[c][1,2]oxaborol-1 hydrochloride (3H)-ol

[00307] Enantiomer A (2.1 g) was treated with 200 mL of 1.6 N HCl in MeOH and stirred at room temperature for 5 hours until the reaction was complete indicated by LC/MS. After water (100 mL) was added, the residue was lyophilized overnight to provide 1.40 g of the title compound as an off-white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 9.16 (br.s., 1H), 8.34 (br.s., 3H), 7.26 (t, 1H), 6.70 - 6.92 (m, 1H), 5.48 ( d, 1H), 4.06 (q, 2H), 3.35 (m, 1H), 2.88 (m, 1H), 1.30 (t, 3H); MS (ESI) m/z = 226.1 (M+1, positive). (S)-3-(Aminomethyl)-4-fluoro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride

[00308] Enantiomer B (2.1 g) was treated with 200 mL of 1.6 N HCl in MeOH and stirred at room temperature for 5 hours until the reaction was complete indicated by LC/MS. After water (100 mL) was added, the residue was lyophilized overnight to provide 1.43 g of the title compound as an off-white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 9.16 (br.s., 1H), 8.31 (br.s., 3H), 7.26 (t, 1H), 6.70 - 6.92 (m, 1H), 5.48 (d, 1H), 4.06 (q, 2H), 3.35 (m, 1H), 2.88 (m, 1H), 1.31 (t, 3H); MS (ESI) m/z = 226.1 (M+1, positive). O. 3-Minornellyl-5-chloro-7-(3-hydroxy-propoxy)-3H-benz.o[c][1,2]oxaborol-1-ol hydrochloride
5-Chloro-2,3-dihydroxy-benzaldehyde
To a solution of 5-chloro-2-hydroxy-3-methoxy-benzaldehyde (7 g, 37.5 mmols) in anhydrous CH 2 Cl 2 (200 mL) at 0°C was added a solution of BBr 3 in CH2Cl2 (1M, 93.7 mL, 93.7 mmols) and the reaction mixture was stirred overnight at room temperature. The solution was diluted with CH2Cl2 (200 mL), washed with water, brine, dried over Na2SO4, filtered and concentrated under reduced pressure giving the title compound (6.2 g, 36.0 mmols, 96%) as a pale yellow solid. . 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 11.02 (s, 1H), 9.83 (s, 1H), 7.18 (s, 1H), 7.14 (d, J=2.3Hz, 1H), 5.71 (s, 1H). 3-(3-benzyloxy-propoxy)-5-chloro-2-hydroxy-benzaldehyde
To a solution of 5-chloro-2,3-dihydroxy-benzaldehyde (3.1 g, 17.7 mmols) in anhydrous DMSO (20 mL) was added NaH (60% in mineral oil, 1, 50 g, 35.4 mmols) portion by portion and the mixture was stirred for 30 minutes. The solution was cooled to 0°C and a solution of 3-benzyloxy-1-bromopropane (3.1ml, 17.7mmol) in DMSO (3ml) was added dropwise over a period of 10 minutes. The ice bath was removed. After overnight, the solution was diluted with EtOAc (100 mL), washed with water, brine, dried over Na2SO4, filtered and concentrated under reduced pressure. The product was purified by silica gel column chromatography (mobile phase 2:1 hexanes-EtOAc) giving the title compound (5.3 g, 16.6 mmols, 94%) as a pale yellow oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.81 (s, 1H), 9.87 (s, 1H), 7.42 - 7.28 (m, 5H), 7.17 (s, 1H), 7.08 (s, 1H), 4.53 (s, 2H), 4.17 (t, J=6.2Hz, 2H), 3.69 (t, J=5.8Hz, 2H), 2.15 (t, J=6.2Hz, 2H) . Trifluoromethanesulfonic acid 2-(3-Benzyloxy-propoxy)-4-chloro-6-formyl-phenyl ester
To a solution of 3-(3-benzyloxy-propoxy)-5-chloro-2-hydroxy-benzaldehyde (5.3 g, 16.6 mmols) and pyridine (3.4 mL, 41.5 mmols) in CH2Cl2 (70 mL) at 0°C was added Tf2O (3.1 mL, 18.3 mmol) dropwise over a period of 5 minutes and the reaction mixture was stirred for 3 h at room temperature. The solution was diluted with CH2Cl2 (100 mL), washed with water, brine, dried over Na2SO4, then concentrated under reduced pressure. The product was purified by silica gel column chromatography (mobile phase 2:1 hexanes-EtOAc) giving the title compound (3.8 g, 8.5 mmols, 51%) as a pale yellow oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.18 (s, 1H), 7.48 (d, J=2.3Hz, 1H), 7.37 - 7.29 (m, 6H), 4.52 (s, 2H) , 4.23 (t, J=6.2Hz, 2H), 3.69 (t, J=5.8Hz, 2H), 2.16 (t, J=6.0Hz, 2H); 19F NMR (376 MHz, CHLOROFORM-d) δ ppm - 73.23 (s). 3-(3-benzyloxy-propoxy)-5-chloro-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
To a solution of trifluoro-methanesulfonic acid 2-(3-benzyloxy-propoxy)-4-chloro-6-formyl-phenyl ester (3.8 g, 8.4 mmols) in anhydrous 1,4-dioxane (50 mL) bis(pinacolato)diboron (4.3 g, 16.9 mmol) and KOAc (2.5 g, 25.4 mmol) were added successively and the resulting solution was degassed with N2 for 20 minutes. PdCl2(dppf) (0.5 g, 0.67 mmol) was added and the resulting mixture was stirred overnight at 90°C. The solution was diluted with EtOAc (100 mL), washed with water, brine, dried over Na2SO4, filtered and concentrated under reduced pressure. The product was purified by silica gel column chromatography (mobile phase 4:1 hexanes-EtOAc) giving the title compound (3.4 g, 7.8 mmol, 92%) as a colorless oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 9.87 (s, 1H), 7.40 - 7.28 (m, 6H), 7.03 (br s, 1H), 4.50 (s, 2H), 4.09 (t , J=6.4Hz, 2H), 3.70 - 3.60 (m, 2H), 2.10 (t, J=6.2Hz, 2H), 1.42 (s, 12H). 7-(3-benzyloxy-propoxy)-5-chloro-3-nitromethyl-3H-benzo[c] [1,2]oxaborol-1-ol
[00313] To a solution of 3-(3-benzyloxy-propoxy)-5-chloro-2-(4,4,5-trimethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde (3, 4g, 7.8mmol) and nitromethane (1.7ml, 31.3mmol) in THF (20ml) was added a solution of NaOH (0.025M, 40ml). After 12 h, 2N HCl was added until the pH was 1. The solution was diluted with EtOAc (150 mL), washed with water, dried over Na2SO4, filtered and concentrated under reduced pressure. The product was purified by silica gel column chromatography (mobile phase 4:1 hexanes-EtOAc) to provide the title compound product (1.7 g, 56%) as a colorless gel. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.39 - 7.28 (m, 5H), 6.92 (s, 1H), 6.83 (s, 1H), 5.85 (br s, 1H), 5.81 (dd , J=8.5, 3.9Hz, 1H), 4.70 (dd, J=13.2, 3.9Hz, 1H), 4.59 (s, 2H), 4.47 (dd, J=13.0, 8.7Hz, 1H), 4.21 - 4.07 (m, 2H), 3.71 - 3.60 (m, 2H), 2.10 (quin, J=5.7Hz, 2H). 5-Chloro-7-(3-hydroxy-propoxy)-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol OH

[00314] 7-(3-benzyloxy-propoxy)-5-chloro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (0.3 g, 0.91 mmols) in MeOH (30 mL) conc HCl (1 mL) and Pd(OH)2 (10% w/w on carbon, 0.2 g) was added and the reaction vessel was pressurized to 40 psi (0.28 MPa) with hydrogen for 30 minutes at room temperature. The mixture was filtered through a pad of Celite® and washed with EtOAc. The filtrate was concentrated in vacuo and the product was purified by prep. (C18 column, using acetonitrile and 0.1% gradient of AcOH/water solution) provided the title compound (80 mg, 33%). 1H NMR (400 MHz, DMSO-d6) δ ppm 9.19 (s, 1H), 7.22 (s, 1H), 6.97 (s, 1H), 5.71 (dd, J=8.9, 2.3Hz, 1H) , 5.32 (dd, J=13.2, 2.7 Hz, 1H), 4.64 (dd, J=13.6, 8.9 Hz, 1H), 4.53 (t, J=4.8 Hz, 1H), 4.12 (t, J= 6.0Hz, 2H), 3.57 (q, J=5.5Hz, 2H), 1.86 (t, J=6.2Hz, 2H). 3-Aminomethyl-5-chloro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol hydrochloride

[00315] To a 5-chloro-7-(3-hydroxy-propoxy)-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol 7 (80 mg, 0.27 mmol) in Methanolic ammonia solution (2M, 20 mL) was added Ra/Ni (~0.1 g, 2800 Nickel slurry in water) and the reaction vessel was pressurized at 40 psi (0.28 MPa) with hydrogen for at night at room temperature. The mixture was filtered through a pad of Celite® and washed with EtOAc. The filtrate was concentrated in vacuo and to the resulting residue was added water (1 mL), followed by conc HCl at pH 1. The heterogeneous mixture was lyophilized providing the title compound as an ivory hygroscopic solid (79 mg, quantitative). 1H NMR (400 MHz, DMSO-d6) δ ppm 7.20 (s, 1H), 6.99 (s, 1H), 5.28 (dd, J=8.0, 2.5Hz, 1H), 4.13 (t, J=6.0 Hz, 2H), 3.59 (t, J=6.0Hz, 2H), 3.47 (dd, J=13.0, 2.5Hz, 1H), 2.89 (dd, J=13.2, 8.6Hz, 1H), 1.89 (t, J=6.0Hz, 2H); MS (ESI) m/z = 272 (M+1, positive); HPLC purity: 96.83% (MaxPlot 200 at 400 nm), 95.40% (220 nm). P. 3-Aminomethyl-7-(3-hydroxy-propoxy)-6-methoxy-3H-benzo[c][1,2]oxaborol-1-ol hydrochloride
3-(3-benzyloxy-propoxy)-2-bromo-4-methoxy-benzaldehyde
[00316] Synthesized according to the methods of the general procedure 4 In the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 2-bromo-3-hydroxy-4-methoxy-benzaldehyde (1.0 g, 4.32 mmols), (3 -bromo-propoxymethyl)-benzene (0.76 mL, 4.32 mmols), cesium carbonate (2.11 g, 6.5 mmols), DMF (30 mL). Purification: flash chromatography (10% EtOAc/hexanes): yield 1.54 g (95%). 1H NMR (400 MHz, CDCl3) δ (ppm): 10.26 (s, 1H), 7.73 (d, J=8.6Hz, 1H), 7.46-7.18 (m, 5H), 6.95 (d, J= 8.6 Hz, 1H), 4.56 (s, 2H), 4.14 (t, J=6.1Hz, 2H), 3.92 (s, 3H), 3.77 (t, J=6.2Hz, 2H), 2.15 (quin, J=6.5Hz, 2H); MS (ESI): m/z = 381 (M+1, positive). 3-(3-benzyloxy-propoxy)-4-methoxy-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
[00317] Synthesized according to the methods of general procedure 5 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-benzyloxy-propoxy)-2-bromo-4-methoxy-benzaldehyde (14.82 g, 39 mmols ), bis(pinacolato)diboron (14.86 g, 58.5 mmols), KOAc (11.46 g, 117 mmols), PdCl2(dppf) (8.5 g, 11.7 mmols), dioxane (200 mL ). Purification: flash column chromatography (15% EtOAc/hexanes): yield 3.42 g (22%). 1H NMR (400 MHz, CDCl 3 ) δ (ppm): 9.79 (s, 1H), 7.53 (d, J=8.2Hz, 1H), 7.40-7.24 (m, 5H), 6.98 (d, J= 8.2 Hz, 1H), 4.53 (s, 2H), 4.12 (t, J=6.4Hz, 2H), 3.88 (s, 3H), 3.69 (t, J=6.4Hz, 2H), 2.10 (quin, J=6.5Hz, 2H), 1.44 (s, 12H). 7-(3-benzyloxy-propoxy)-6-methoxy-3-nitromethyl-3H-benzo[c] [1,2]oxaborol-1-ol

[00318] Synthesized according to the methods of general procedure 8 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-benzyloxy-propoxy)-4-methoxy-2-(4,4,5,5-tetramethyl- [1,3,2]dioxaborolan-2-yl)-benzaldehyde (3.36 g, 7.88 mmols), nitromethane (1.28 mL, 23.66 mmols), NaOH (0.22 g, 5.52 mmols), THF (6 mL), water (18 mL). Purification: Flash column chromatography (30% EtOAc/Hexanes): 1.2 g yield (41%). 1H NMR (400 MHz, DMSO-d6) δ (ppm): 9.36 (s, 1H), 7.40-7.22 (m, 5H), 7.22-7.04 (m, 2H), 5.68 (dd, J=9.4 , 2.7Hz, 1H), 5.29 (dd, J=13.4, 2.5Hz, 1H), 4.52 (dd, J=13.3, 9.4Hz, 1H), 4.45 (s, 2H), 4.25 (t, J=6.2Hz, 2H), 3.75 (s, 3H), 3.61 (t, J=6.2Hz, 2H), 1.92 (quin, J=6.5Hz, 2H). 3-Aminomethyl-7-(3-hydroxy-propoxy)-6-methoxy-3H-benzo[c][1,2]oxaborol-1-ol hydrochloride;

[00319] To a solution of 7-(3-benzyloxy-propoxy)-6-methoxy-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (0.5 g, 1.29 mmol) in methanolic ammonia (10 mL) was added palladium hydroxide (0.25 g, 45% by weight) to a hydrogenation bottle and the bottle was charged with hydrogen at 45 psi (0.31 MPa) for 18 h. The catalyst was filtered off and the solvent was evaporated under reduced pressure. In order to ensure that all ammonia has been stripped out, the compost was subjected to high vacuum for 1 h. The crude product (0.4 g) obtained was further dissolved in methanol (15 mL) and transferred to a hydrogenation bottle and concentrated HCl (5 to 6 drops) was added to make pH 2. To this solution palladium hydroxide ( 0.11 g, 25% by weight) was added and the flask was charged with hydrogen to 45 psi (0.31 MPa) for 1.5 h. The catalyst was filtered off through a pad of Celite and the solvent evaporated. Purification was carried out by preparative HPLC yielding 0.16 g (41%) of the title compound as a white solid. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 8.06 (br.s, 1H), 7.17 (d, J=8.2Hz, 1H), 7.12 - 7.02 (m, 1H), 5.32( dd, J=7.8, 2.3 Hz, 1H), 4.46 - 4.27 (m, 2H), 4.14 (t, J=4.5Hz, 2H), 3.78 (s, 3H), 3.44 (dd, J= 13.3, 2.7Hz, 1H), 2.88 (dd, J=13.3, 8.2Hz, 1H), 2.08 - 1.94 (m, 2H); MS (ESI): m/z = 268 (M+1, positive); HPLC purity: 95.35% (MaxPlot 200 - 400 nm), 97.48% (220 nm). Q. 3-Aiminoylmethyl-7-(3-hydroxy-propoxy)-6-imethyl-3H-benz,o[c][1,2]oxaborol-1-ol; hydrochloride
1,2-Dimethoxy-3-methyl-benzene
To a cooled (0°C) solution of 1,2-dimethoxy-3-methylbenzene (2.05 g, 13.45 mmols) and TMEDA (2.8 mL, 18.83 mmols) in diethyl ether ( 100ml) was added t-butyllithium (1.7M in pentane, 9.5ml, 16.14mmols). The color of the solution changed to light yellow and after a few minutes a white precipitate was observed. The suspension was stirred at room temperature for 18 h, cooled to 0°C and dimethylformamide (2.08 ml, 26.90 mmols) was added dropwise. The precipitate disappeared and the color of the solution changed to light pink. After stirring for 0.5 h, ice was added followed by 1N HCl (30 ml), the compound was extracted into ethyl acetate, dried (Na 2 SO 4 ) and the solvent was evaporated to obtain a light brown oil. Purification by flash column chromatography (5% EtOAc/hexane) gave the title compound: 1.4 g yield (58%). 1H NMR (400 MHz, CDCl3) δ (ppm): 10.34 (s, 1H), 7.49 (d, J=8.2Hz, 1H), 7.01 (d, J=7.8Hz, 1H), 4.00 (s , 3H), 3.86 (s, 3H), 2.33 (s, 3H). MS (ESI): m/z =181 (M+1, positive). 2,3-Dihydroxy-4-methyl-benzaldehyde
To a solution of 1,2-dimethoxy-3-methyl-benzene (13.8 g, 76.66 mmols) cooled to -30°C (dry ice/acetone) in dichloromethane (200 mL) boron trichloride (230ml, 230mmol) was added dropwise and the mixture was allowed to stir overnight at room temperature. The solution was cooled to 0°C and ice/water was added carefully, and then extracted with excess dichloromethane. The organic layer was washed with water, dried (Na2SO4) and the solvent was evaporated. Purification by silica gel column chromatography (10 to 20% EtOAc/hexane) provided the title compound as a crystalline solid: yield 9.2 g (80%). 1H NMR (400 MHz, CDCl3) δ (ppm): 11.11 (s, 1H), 9.82 (s, 1H), 7.05 (d, J=8.2 Hz, 1H), 6.81 (d, J=8.6 Hz) , 1H), 5.67 (s, 1H), 2.33 (s, 3H). 3-(3-benzyloxy-propoxy)-2-hydroxy-4-methyl-benzaldehyde
[00322] [0013] Synthesized according to the methods of general procedure 4 in the Pub. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 2,3-dihydroxy-4-methyl-benzaldehyde (9 g, 59.21 mmols), (3-bromo), -propoxymethyl)-benzene (11.5 mL, 65.13 mmols), sodium tert-butoxide (12.52 g, 130.26 mmols) and DMSO (100 mL). Purification: Flash column chromatography (5 to 10% EtOAc/Hexane): yield 15.1 g (85%). 1H NMR (400 MHz, CDCl 3 ) δ (ppm): 11.05 (s, 1H), 9.84 (s, 1H), 7.38-7.26 (m, 5H), 7.20 (d, J=7.8Hz, 1H ), 6.80 (d, J=8.2 Hz, 1H), 4.55 (s, 2H), 4.15 (t, J=6.2Hz, 2H), 3.73 (t, J=6.2Hz, 2H), 2.31 (s, 3H), 2.19-2.00 (m, 2H). Trifluoromethanesulfonic acid 2-(3-Benzyloxy-propoxy)-6-formyl-3-methyl-phenyl ester
[00323] Synthesized according to the methods of general procedure 6 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-benzyloxy-propoxy)-2-hydroxy-4-methyl-benzaldehyde (0.3 g, 1, 0mmol), trifluoromethanesulfonic acid (0.34ml, 2.0mmol), pyridine (0.25ml, 3.1mmol), dichloromethane (15ml). Purification: flash column chromatography (10 to 15% EtOAc/hexane): yield 0.25 g (59%). 1H NMR (400MHz, CDCl3) δ (ppm): 10.14 (s, 1H), 7.61 (d, J=7.8Hz, 1H), 7.42-7.29 (m, 6H), 4.53 (s, 2H ), 4.07 (t, J=6.4Hz, 2H), 3.71 (t, J=6.1Hz, 2H), 2.40 (s, 3H), 2.07 - 2.22 (m, 2H). 19F NMR (400 MHz, CDCl 3 ) δ (ppm): -73.63 (s). 3-(3-benzyloxy-propoxy)-4-methyl-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
[00324] [0014] Synthesized according to the methods of general procedure 5 in the Pub. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and quantities: Trifluoromethanesulfonic acid 2-(3-benzyloxy-propoxy)-6-formyl-3-methyl-phenyl ester (0 .26 g, 0.6 mmol), bis(pinacolato)diboron (0.31 g, 1.2 mmol), KOAc (0.18 g, 1.8 mmol), PdCl2(dppf) (0.13 g, 0.18 mmol), THF (10 mL). Purification: flash column chromatography (15% EtOAc/hexane): yield 0.091 g (36%). 1H NMR (400 MHz, CDCl3) δ (ppm): 9.89 (s, 1H), 7.47 (d, J=7.4Hz, 1H), 7.40-7.25 (m, 6H), 4.52 (s, 2H) ), 4.02 (t, J=6.4Hz, 2H), 3.70 (t, J=6.2Hz, 2H), 2.32 (s, 3H), 2.20-2.08 (m, 2H), 1.45 (s, 12H). 7-(3-benzyloxy-propoxy)-6-methyl-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol

[00325] Synthesized according to the methods of general procedure 8 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-benzyloxy-propoxy)-4-methyl-2-(4,4,5,5-tetramethyl- [1,3,2]dioxaborolan-2-yl)-benzaldehyde (1.14 g, 2.78 mmols), nitromethane (0.45 mL, 8.34 mmols), NaOH (0.78 g, 1.95 mmol), THF (3 mL) and water (9 mL). Purification: flash column chromatography (25% EtOAc/hexanes): yield 0.42 g (41%). 1H NMR (400 MHz, DMSO-d6) δ (ppm): 9.41 (s, 1H), 7.37-7.18 (m, 6H), 7.03 (d, J=7.8Hz, 1H), 5.69 (dd, J=9.2, 2.5 Hz, 1H), 5.28 (dd, J=13.7, 2.7Hz, 1H), 4.52 (dd, J=13.3, 9.4Hz, 1H), 4.46 (s, 2H), 4.33 (t, J=6.1Hz, 2H), 3.58 (t, J=6.1Hz, 2H), 2.12 (s, 3H), 2.01-1.87 (m, 2H). MS (ESI): m/z = 370 (M-1, negative). 3-Aminomethyl-7-(3-hydroxy-propoxy)-6-methyl-3H benzo[c][1,2]oxaborol-1-ol hydrochloride

[00326] To a solution of 7-(3-benzyloxy-propoxy)-6-methyl-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (0.42 g, 1.13 mmol) in methanolic ammonia (15 mL) was added palladium hydroxide (0.2 g, 45 wt%) into a hydrogenation bottle and the bottle was charged with hydrogen at 45 psi (0.31 MPa) for 18 h. The catalyst was filtered off and the solvent was evaporated under reduced pressure. In order to ensure that all ammonia has been stripped out, the compost was subjected to high vacuum for 1 h. The crude product (0.38 g) obtained was further dissolved in methanol (15 mL) and transferred to a hydrogenation bottle and concentrated HCl (5 to 6 drops) was added to make pH 2. To this solution palladium hydroxide ( 0.1 g, 25% by weight) was added and the flask was charged with hydrogen at 45 psi (0.31 MPa) for 1.5 h. The catalyst was filtered off through a pad of Celite and the solvent evaporated. Purification by preparative HPLC provided 0.12 g (39%) of the title compound as a white solid. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 8.40 (s, 1H), 7.12 (d, J=7.4Hz, 1H), 6.80 (d, J=7.4Hz, 1H), 5.08 -4.91 (m, 1H), 4.49-4.21 (m, 2H), 3.64 (t, J=5.7Hz, 2H), 3.17 (dd, J=12.9, 3.1Hz, 1H), 2.66 (dd , J=12.7, 8.0Hz, 1H), 2.14 (s, 3H), 1.81 (quin, J=5.7Hz, 2H). MS (ESI): m/z = 252 (M+1, positive); HPLC purity: 98.25% (MaxPlot 200 at 400 nm), 98.39% (220 nm). R. 3-Ammomethyl-6-fluoro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol; hydrochloride salt Ph
4-Fluoro-2,3-dihydroxy-benzaldehyde
To a solution of 3-fluoro-benzene-1,2-diol (20 g, 156 mmols) in anhydrous acetonitrile (400 mL) was added magnesium chloride (37.1 g, 312 mmols), paraformaldehyde (31 .6 g) and triethylamine (134 ml, 975 mmols). The reaction mixture was heated at 80°C for 8 h. The reaction mixture was cooled to room temperature and the solid was collected by filtration. The solid was treated with 2N cold HCl and the aqueous layer was extracted with EtOAc. The organic layer was concentrated in vacuo, yielding 20.4 g of crude product. After a second run 40.8 g of crude product were dissolved in DMF (1 L), cooled to 0°C, added to CS 2 CO 3 (340 g, 1.04 mol) portion by portion. Then methyl iodide (330 mL, 5.28 mol) was added. After warming to room temperature and stirring overnight the solution was filtered, ethyl acetate was added and the organic layer was washed with water (3X). After concentration in vacuo the product was purified by Biotage silica gel chromatography (2% to 3% to 10% to 20% EtOAc/hexanes) resulting in 14.8 g of the dimethoxy compound. This material was dissolved in DCM and cooled to -30°C and BCI3 (1M in DCM, 134 mL, 0.1343 mol) was added to the solution at -30°C. After overnight at room temperature, the solution was cooled to -70°C and BBr3 (1M in DCM, 67.25 ml, 0.067 mol) was added. Then, overnight warming to room temperature, the solution was cooled in an ice bath and slowly ice water was added. The DCM layer was separated and the aqueous layer was extracted with DCM (2X). The combined organic layer was extracted with brine (2X), dried over Na2SO4, filtered and concentrated in vacuo. After triturating the residue obtained with hexanes/DCM (6:4) 5.60 g (yield 11%) of the title compound obtained was a pink-brown solid. This material was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 11.36 (s, 1H), 9.83 (s, 1H), 7.16 - 7.13 (m, 1H), 6.82 - 6.78 (m, 1H), 5.48 (brs , 1H). 19F NMR (376 MHz, DMSO-d6 with D2O) δ (ppm): -119.03 - -119.08 (m, 1F). 3-(3-benzyloxy-propoxy)-4-fluoro-2-hydroxy-benzaldehyde
[00328] Synthesized according to the methods of general procedure 4 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 4-fluoro-2,3-dihydroxybenzaldehyde (5.15 g, 32.9 mmols), NaOtBu (6.95 g , 72.3 mmols), DMSO (200 mL), (3-bromo-propoxymethyl)-benzene (8.31 g, 36.3 mmols). Purification: Biotage silica gel chromatography (gradient hexanes/ethyl acetate) gave 4.00 g of a mixture of the title compound and the dialkylated product. This material was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 10.13 (s, 1H), 7.66 -7.54 (m, 5H), 7.53 - 7.33 (m, 1H), 6.92 - 6.90 (m, 1H), 4.53 (s, 2H), 4.52 - 4.44 (m, 2H), 3.71 - 3.62 (m, 2H), 2.18 - 2.13 (m, 2H). 19F NMR (376 MHz, DMSO-d6 with D2O) δ (ppm): -121.03 - -121.08 (m, 1F) 3-(3-benzyloxy-propoxy)-4-fluor-2-(4,4,5, 5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
[00329] Synthesized according to the methods of general procedure 6 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-Benzyloxy-propoxy)-4-fluoro-2-hydroxy-benzaldehyde (4.00 g, 13.1 mmols ), pyridine (2.34 ml, 28.9 mmols), DCM (100 ml), triflate anhydride (2.21 ml, 13.5 mmols). Purification: Biotage silica gel chromatography (gradient hexanes/ethyl acetate) generated 2.00 g of triflate which was used immediately according to general procedure 5 in Pat. U.S. No. 20090227541 (U.S. Pat. Application No. 12/142,692).
[00330] Synthesized according to the methods of general procedure 5 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and quantities: trifluoro-methanesulfonic acid 2-(3-benzyloxy-propoxy)-3-fluoro-6-formyl-phenyl ester (2 0.0g, 4.57mmols), THF (15ml), B2pin2 (2.20g, 8.66mmols), KOAc (1.60g, 16.3mmols), PdCl2(dppf).DCM (0 .40 g, 0.55 mmol). Purification: Biotage silica gel chromatography (gradient hexanes/ethyl acetate) gave 0.50 g (26% yield) of the title compound. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 9.86 (s, 1H), 7.51 (dd, J = 8.2, 4.0 Hz, 1H), 7.34 - 7.31 (m, 5H), 7.21 (dd, J = 11.0, 8.2 Hz, 1H), 4.51 (s, 2H), 4.24 (td, J = 6.5, 2.0 Hz, 2H), 3.67 (t, J = 6.2 Hz, 2H), 2.11 - 2.07 (m, 2H) ; 1.33 (s, 12H); 19F NMR (376 MHz, DMSO-d6 with D2O) δ (ppm): -120.3 - -121.1 (m, 1F). 7-(3-benzyloxy-propoxy)-6-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol PH

[00331] Synthesized according to the methods of general procedure 8 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 3-(3-benzyloxy-propoxy)-4-fluoro-2-(4,4,5,5-tetramethyl- [1,3,2]dioxaborolan-2-yl)-benzaldehyde (0.40 g, 0.966 mmol), nitromethane (0.15 mL, 2.89 mmols), NaOH (0.038 g, 0.96 mmol), THF (10 ml), water (10 ml). This generated 0.34 g (94% yield) of the title compound. 1H NMR (400 MHz, DMSO-d6) δ (ppm): 9.83 (s, 1H), 7.32 - 7.02 (m, 7H), 5.78 - 5.75 (m, 1H), 5.28 -5.23 (m, 1H), 4.60 - 4.56 (m, 1H), 4.42 (s, 2H), 4.37 (brs, 2H), 3.57 (brs, 2H), 1.92 (brs, 2H). 19F NMR (376 MHz, DMSO-d6 with D2O) δ (ppm): -132.3 (1F). 3-Aminomethyl-6-fluoro-7-(3-hydroxy-propoxy)-3H-benzo[c][1,2]oxaborol-1-ol; hydrochloride salt

[00332] To a mixture of 7-(3-benzyloxy-propoxy)-6-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (0.34 g, 0.906 mmol) and methanolic ammonia (2M, 20 mL) in a Parr apparatus was added Pd(OH)2 on carbon (0.30 g). The apparatus was charged with hydrogen (~40 psi) (0.28 MPa) and stirred overnight at room temperature. The suspension was filtered through Celite® with methanol washing and concentrated in vacuo. The 310 mg of the cream colored solid was dissolved in methanol (20 ml), transferred to Parr apparatus and the pH was adjusted to ~ 3 with a few drops of concentrated HCl. Then Pd(OH)2 on carbon (0.20 g) was added and the apparatus was charged with hydrogen (~40 psi) (0.28 MPa). After 35 minutes, the suspension was filtered through Celite® with a methanol wash and concentrated in vacuo. Purification was carried out by preparative reverse phase HPLC (acetonitrile/water gradient (0.1% AcOH)) giving 100 mg (yield 43%) of the title compound as a white solid. mp 265 - 267 °C; 1H NMR (400 MHz, DMSO-d6 with D2O) δ (ppm): 7.41 (dd, J = 11.1, 8.2 Hz, 1H), 7.07 (dd, J = 7.9, 2.8 Hz, 1H), 5.29 (d, J = 7.0 Hz, 1H), 4.36 (t, J = 6.0 Hz, 2H), 3.62 (br.s, 2H), 3.45 (d, J = 12.9 Hz, 1H), 2.92 - 2.86 (m, 1H) , 1.93 - 1.83 (m, 2H); 19F NMR (376 MHz, DMSO-d6 with D2O) δ (ppm): -135.0 (1F); MS (ESI) m/z = 256 (M+1, positive); HPLC purity: 98.57% (MaxPlot 200 at 400 nm), 97.28% (220 nm). S. 3-Aminomethyl-7-ethoxy-6-methoxy-3H-benz.o[c][1,2]oxaborol-1-ol; hydrochloric acid salt
2-Bromo-3-ethoxy-4-methoxy-benzaldehyde
[00333] Ethyl bromide [0015] (2.88 g, 26.4 mmols) was added to a mixture of 2-bromo-3-hydroxy-4-methoxybenzaldehyde (5.08 g, 22 mmols) and potassium carbonate (4.56 g, 33 mmols) in anhydrous DMF (50 mL) at room temperature under nitrogen. The reaction mixture was stirred at 35°C for 18 h, diluted with EtOAc (150 mL), washed with water (2x50 mL), brine, dried over Na 2 SO 4 and concentrated to provide the crude product as a white solid. Purification by silica column chromatography (eluent: 30% EtOAc in Hexanes) to give 5.65 g (99% yield) of the title compound as a white solid. 1H NMR (400 MHz, CDCl 3 ) δ (ppm) 10.26 (s, 1H), 7.73 (d, J = 8.4 Hz, 1H), 6.95 (d, J = 8.8 Hz, 1H), 4.08 (q, J = 7.1 Hz, 2H), 3.95 (s, 3H), 1.46 (t, J = 7.0 Hz, 3H); MS (ESI) m/z = 261 (M+1, positive). [3-Ethoxy-4-methoxy-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
[00334] Synthesized according to the methods of general procedure 5 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: 2-bromo-3-ethoxy-4-methoxy-benzaldehyde (4 g, 15.43 mmols), KOAc (4, 55 g, 46.29 mmols), bis(pinacolato)diboron (7.84 g, 30.86 mmols). PdCl2(dppf) (0.91 g, 1.24 mmol) in dry dioxane (90 mL). The crude product was purified by silica gel column chromatography (eluent: EtOAc/hexanes 1:9 then 1:3) to afford the title compound as a white solid (1.50 g, 32% yield). 1H NMR (400 MHz, CDCl3) δ (ppm) 9.71 (s, 1H), 7.44 (d, J = 8.4 Hz, 1H), 6.89 (d, J = 8.4 Hz, 1H), 4.01 (q, J = 7.1 Hz, 2H), 3.82 (s, 3H), 1.38 (s, 12H), 1.35 (t, J = 7.0 Hz, 3H). 7-Ethoxy-6-methoxy-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol

[00335] Synthesized according to the methods of general procedure 9 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and amounts: [3-ethoxy-4-methoxy-2-(4,4,5,5-tetramethyl-[1,3, 2]dioxaborolan-2-yl)-benzaldehyde (1.47 g, 4.80 mmols), nitromethane (0.92 g, 14.4 mmols), CATBr (88 mg, 0.24 mmol) in dry THF (20 mL) and NaOH (0.025 M aqueous solution). Purification by silica gel column chromatography (eluent: 10% EtOAc/hexane to 30% EtOAc/hexane) to obtain the title compound as a yellow solid (0.75 g, 59%). 1H NMR (400 MHz, DMSO-d6 + D2O (0.01 ml)} δ (ppm) 9.34 (s, 1H), 7.18 (d, J = 8.1 Hz, 1H), 7.11 (d, J = 8.0 Hz, 1H) , 5.68 (dd, J = 9.2, 2.0 Hz, 1H), 5.29 (dd, J = 13.2, 2.8 Hz, 1H), 4.55-4.50 (m, 1H), 4.20 (q, J = 7.0 Hz, 2H), 3.77 (s, 3H), 1.27 (t, J = 7.0 Hz, 3H); MS (ESI) m/z = 261 (M-1, negative). 3-Aminomethyl-7-ethoxy-6-methoxy-3H-benzo[c][1,2]oxaborol-1-ol; hydrochloride salt

[00336] Synthesized according to the methods of general procedure 13 in the Pub. of Pat. US No. 20090227541 (US Pat. Application No. 12/142,692) using the following reagents and quantities: 7-Ethoxy-6-methoxy-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1- ol (0.97 g, 3.63 mmols), glacial acetic acid (20 mL), Pd(OH)2 on carbon (20% metal content, 50% wet weight) (300 mg). Purification: Preparative HPLC (C18 column, using acetonitrile and 0.1% AcOH/water solution) provided the title compound (0.28 g; 28% yield). mp 202-204oC. 1H NMR (400 MHz, CD3OD) δ (ppm) 7.20 (d, J = 8.0 Hz, 1H), 7.08 (d, J = 8.1 Hz, 1H), 5.40 (dd, J = 8.4, 2.8 Hz, 1H), 4.23 (q, J = 7.1 Hz, 2H), 3.31 (s, 3H), 3.56 (dd, J = 13.6, 7.2 Hz, 1H), 2.92 (dd, J = 13.2, 7.2 Hz 1H), 1.33 (t, J=7Hz, 3H); MS (ESI) m/z = 238 (M+1, positive); HPLC purity: 98.79% (MaxPlot 200 at 400 nm) and 99.13% (220 nm). T. 3-Ammomethyl-7-ethoxy-6-fluoro-3H-benz.o[c][1,2]oxaborol-1-ol; hydrochloride salt

4-Fluoro-2,3-dihydroxybenzaldehyde
To a -78°C solution of 2,3-dimethoxy-4-fluorobenzaldehyde (7.0 g, 38.0 mmols) in dry dichloromethane (150 mL) was added dropwise BBr3 (23.8 g). , 95.0 mmols) in dichloromethane (30 ml). The reaction mixture was allowed to reach room temperature and stirred for 18 h. Then, the reaction mixture was cooled to -78°C, and quenched with a mixture of methanol (10 ml) and water (50 ml) and stirred at room temperature for 30 min. The precipitated solid was filtered off and washed with cooled dichloromethane. The dichloromethane layer was concentrated to yield the title compound as a solid (5.2 g, 88%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm: 11.38 (s, 1H), 9.84 (s, 1H), 7.15 (dd, J=8.6, 5.5Hz, 1H), 6.81 (t, J= 9.4 Hz, 1H), 5.47 (s, 1H); MS (ESI) m/z = 155 (M-1, negative). 3-Ethoxy-4-fluor-2-hydroxybenzaldehyde
To a solution of 2,3-dihydroxy-4-fluorobenzaldehyde (3.0 g, 19.23 mmols) in DMSO (100 mL), NaOBu-t (3.692 g, 38.46 mmols) was added in portions at room temperature and stirred for 15 min. Then iodoethane was added dropwise at room temperature and stirred for 18 h. The reaction mixture was poured into crushed ice (200 mL) and acidified with 2.5 M HCl to pH 3.0. The product was extracted with ethyl acetate (2 x 100 mL), concentrated and the product chromatographed on a silica gel column (Hex:EtOAc = 95:5) to afford the title compound as a crystalline solid (2.3 g, 65%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm: 11.36 (s, 1H), 9.83 (s, 1H), 7.39 - 7.19 (m, 1H), 6.77 (t, J=9.2Hz, 1H) ), 4.22 (q, J=7.0Hz, 2H), 1.40 (t, J=7.0Hz, 3H); MS (ESI) m/z = 183 (M+1, positive). Trifluoromethanesulfonic acid 2-ethoxy-3-fluoro-6-formyl-phenyl ester
To a mixture of 3-ethoxy-4-fluoro-2-hydroxybenzaldehyde (2.208 g, 12.0 mmols) and pyridine (1.986 g, 24.0 mmols) in dichloromethane (30.0 mL) at 0°C trifluoromethanesulfonic anhydride (4.060, 14.4 mmols) in dichloromethane (5.0 mL) was added dropwise. The reaction mixture was stirred at 0°C for 2 h and at room temperature for 3 h. Then diluted with dichloromethane (40 mL), washed with 2M HCl, brine and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure to provide the title compound as a pale yellow liquid (3.3 g, 87%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm: 10.15 (s, 1H), 7.66 (dd, J=8.6, 5.5Hz, 1H), 7.28 - 7.22 (m, 1H), 4.36 (q, J=6.9 Hz, 2H), 1.47 (t, J=7.0Hz, 3H). 3-Ethoxy-4-fluoro-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde
To a solution of trifluoromethanesulfonic acid 2-ethoxy-3-fluoro-6-formyl-phenyl ester (2.2 g, 6.96 mmols) in dry THF (35.0 mL) bis(pinacolato)diboron ( 2.134 g, 8.4 mmols), PdCl2(dppf) (367 mg, 0.5 mmol) and potassium acetate (1.372 g, 14.0 mmols) were added and purged with nitrogen for 15 min. The reaction mixture was heated under reflux for 24 h. Cooled to room temperature and diluted with ethyl acetate (40 mL) and filtered through Celite. The solvent was removed under reduced pressure and the residue was chromatographed on a silica gel column (Hex:EtOAc = 9:1) to provide the title compound as an off-white solid (850.0 mg, 42%). 1H NMR (400 MHz, CHLOROFORM-d) δ ppm: 9.87 (s, 1H), 7.51 (dd, J=8.2, 4.3Hz, 1H), 7.22 (dd, J=10.9, 8.6Hz, 1H) , 4.20 (q, J=7.0Hz, 2H), 1.46 (s, 12H), 1.40 (t, J=7.0Hz, 3H); MS (ESI) m/z = 295 (M+1, positive). 7-Ethoxy-6-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol

To a cooled solution of sodium hydroxide (80 mg, 2.0 mmols) in water (3.0 mL), nitromethane (244.0 mg, 4.0 mmols) was added at 0°C and stirred by 10 min. Then 3-ethoxy-4-fluoro-2-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-benzaldehyde (588.0 mg, 2.0 mmols) in THF (5.0 mL) was added. The reaction mixture was stirred for 1 h at 0°C and for 2 h at room temperature. The reaction mixture was acidified with 2.5 M HCl (1.0 mL) and the product was extracted with ethyl acetate (2 x 20 mL). The organic extracts were combined and washed with brine and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure and the product was chromatographed on a silica gel column (CH 2 Cl 2 : MeOH = 95:5) to provide the title compound as a solid (350 mg, 69%). 1H NMR (400 MHz, DMSO-d6) δ ppm: 7.40 (dd, J=11.3, 8.2 Hz, 1H), 7.16 (dd, J=8.0, 3.3Hz, 1H), 5.74 (d, J=9.0 Hz, 1H), 5.30 (dd, J=13.5, 2.2Hz, 1H), 4.62 (dd, J=13.5, 9.2Hz, 1H), 4.35 (q, J=6.8Hz, 2H), 1.28 (t, J=6.8Hz, 3H); MS (ESI) m/z = 254 (M-1, negative). 3-Aminomethyl-7-ethoxy-6-fluoro-3H-benzo[c][1,2]oxaborol-1-ol; hydrochloride salt

[00342] To a solution of 7-ethoxy-6-fluoro-3-nitromethyl-3H-benzo[c][1,2]oxaborol-1-ol (320.0 mg, 1.25 mmol) in methanol (5 .0 mL), 5.0 mL of 2M ammonia in methanol and 160 mg of Pd(OH)2 in C were added and hydrogenated at 45 PSI (0.31 MPa) for 18 h. The catalyst was removed by filtration and the filtrate was concentrated to give an off-white solid (250 mg). This solid was dissolved in methanol (3 mL) and 3.0 mL of 1.2 M HCl in methanol was added and stirred at room temperature for 3 h. Excess HCl and solvent were removed under reduced pressure and the product was triturated with ether to provide the title compound as an off white solid (140mg, 43%). 1H NMR (400 MHz, DMSO-d6) δ ppm: 9.43 (s, 1H), 8.13 (br.s., 3H), 7.40 (dd, J=11.5, 8.0Hz, 1H), 7.16 (dd , J=7.8, 3.1Hz, 1H), 5.32 (d, J=6.3Hz, 1H), 4.35 (q, J=7.0Hz, 2H), 3.43 (br.s., 1H), 2.92 (br.s., 1H), 1.29 (t, J=7.0Hz, 3H); 19F NMR (376 MHz, DMSO-d6) δppm -135 (s, 1F); MS (ESI) m/z = 226 (M+1, positive); HPLC purity: 95.81% (MaxPlot 200 at 400 nm), 94.73% (220 nm). U. 3-(Aminomethyl)-5-chloro-7-ethoxybenz.o[c][1,2]oxaborol-1(3H)-ol
4-Chloro-2-ethoxy-6-formylphenyl trifluoromethanesulfonate
To a solution of 3-ethoxy-2-hydroxybenzaldehyde (20 g, 120.4 mmols) in AcOH (200 mL) was added N-chlorosuccinimide (16.1 g, 120.4 mmols). The reaction mixture was heated to 105oC for 30 min. After cooled to room temperature, the mixture was stirred for an additional 2.5 h. Subsequently, 200 ml of water was added slowly over 10 min. The mixture was filtered and dried to provide a yellow solid, which was recrystallized from ethanol to provide 4 g of the target compound (4 g, 17% yield). 4-Chloro-2-ethoxy-6-formylphenyl trifluoromethanesulfonate
To a solution of 5-chloro-3-ethoxy-2-hydroxybenzaldehyde (2.0 g, 10.0 mmols) in pyridine (2 mL) and DCM (20 mL) at 0°C was added dropwise trifluoromethanesulfonic anhydride (1 mL). The reaction was stirred for 1 h at 0°C before being quenched with ice water. The organic layer was washed with sat. aqueous (20 mL) and brine (20 mL), dried over anhydrous Na2SO4 and then concentrated in vacuo. The residue was purified by silica gel column chromatography to provide the target compound (2.0 g, yield: 60%). 5-Chloro-3-ethoxy-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzaldehyde
A mixture of 4-chloro-2-ethoxy-6-formylphenyl trifluoromethanesulfonate (330 mg, 1 mmol), KOAc (350 mg, 2.0 mmols), bis(pinacolato)diboron (600 mg, 2.0 mmols) and PdCl2(dppf)CH2Cl2 (65 mg, 0.08 mmol, 8% mol) in dioxane (30 mL) was degassed for 15 min with N2 and stirred at 100°C for 3 h. After being quenched with ice water, the reaction mixture was extracted with EtOAc (3x30 mL). The organic layers were washed with sat. anhydrous (20 mL) and brine (20 mL), dried over anhydrous Na2SO4 and then concentrated. The residue was purified by silica gel column chromatography to give the compound (150 mg, yield: 43%). 5-Chloro-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol
[00346] A mixture of 5-chloro-3-ethoxy-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzaldehyde (310 mg, 1 mmol), NaOH ( 40mg, 1mmol) and CTAB (5mg, 0.05mmol) in H 2 O (2ml) and THF (10ml) was stirred for 0.5h at room temperature. After dropwise addition of nitromethane (0.2 mL, 2 mmols), the reaction mixture was stirred at room temperature for 3 h. Then, cyclization was provided by adding dilute aqueous HCl solution (2N) to pH=2 and then extracted with EtOAc (3x30 mL). The organic layers were washed with brine (25 mL), dried over anhydrous Na2SO4 and concentrated to dryness. The residue was purified by preparative HPLC to provide the compound (100 mg, yield: 56%). 1H NMR (400 MHz, DMSO-d6) δ 9.20 (s, 1H), 7.22 (s, 1H), 6.96 (s, 1H), 5.69-5.72 (m, 1H), 5.30-5.34 (m, 1H) , 4.61-4.67 (m, 1H), 4.10-4.15 (m, 2H), 1.31-1.34 (m, 3H); 3-(Aminomethyl)-5-chloro-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol

A mixture of 5-chloro-7-ethoxy-3-(nitromethyl)benzo[c][1,2]oxaborol-1(3H)-ol (270 mg, 1.0 mmol), Raney -Ni (~125 mg) and 2M NH3 in EtOH (2 mL) in EtOH (10 mL) was stirred under an atmosphere of H2 for 2 h at room temperature. The mixture was filtered through a bed of Celite and the filtrate was concentrated in vacuo. The crude amine was dissolved in EtOAc (2 mL) and the HCl solution in Et2O (20 mL) was added immediately. After 1 h, the suspension was filtered and the resulting solid was washed with hexanes to provide the target compound (100 mg, yield: 43%). 1 HNMR (400 MHz, DMSO-d6) δ 9.06 (s, 1H), 8.18 (s, 3H), 7.22 (s, 1H), 6.96 (s, 1H), 5.27-5.29 (m, 1H), 4.10-4.13 (m, 2H), 3.40-3.47 (m, 1H), 2.87-2.92 (m, 1H), 1.30-1.36 (m, 3H); MS (ESI) m/z = 242 [M + H]+. V. (S)-3-(aminomethyl)-4-bromo-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride Step 1: (7-ethoxy-1-hydroxy-1 tert-butyl ,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methylcarbamate

To a mixture of 3-(aminomethyl)-7-ethoxybenzo[c][1,2]oxaborol-1(3H)-ol hydrochloride salt (5.0 g, 20.5 mmols) and triethylamine (10 0.4g, 103.0mmol) in dichloromethane (250ml) at 0°C was added di-tert-butyl dicarbonate (6.7g, 30.8mmol). The mixture was stirred for 4 h at room temperature. After the reaction was quenched with sat. (500 mL), the resulting mixture was extracted with EtOAc (3x300 mL), and the combined organic layers were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by flash column chromatography (2.5% to 5.0% MeOH in DCM) to provide the product (5.51 g, 87% yield). Step 2: tert-butyl (4-bromo-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)-methylcarbamate

To tert-butyl (7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)methyl-carbamate solution (5.5 g, 17 0.9 mmols) and 1-bromopyrrolidine-2,5-dione (3.8 g, 21.5 mmols) in CH 3 CN (1100 mL) was added 2,2'-Azobis(2-methylpropionitrile (220 mg). was stirred for 1 h at 90°C. The reaction mixture was then concentrated under high vacuum and the residue was purified by column chromatography (2.5% to 5.0% MeOH in DCM) to provide the product (3 0.7 g, 54% yield.1H NMR (300 MHz, DMSO-d6) 8.90 (s, 1H), 7.55-7.53 (d, 1H), 6.85-6.82 (d, 1H), 5.08-5.07 (d) , 1H), 4.11-4.07 (m, 2H), 3.82-3.79 (bd, 1H), 3.06-3.03 (m, 1H), 1.39 (s, 9H), 1.30 (t, 3H); MS (ESI) m /z = 387 [M + H]+. ethoxybenzo[c][1,2]oxaborol-1(3H)-ol

[00350] A mixture of tert-butyl (4-bromo-7-ethoxy-1-hydroxy-1,3-dihydrobenzo[c][1,2]oxaborol-3-yl)-methylcarbamate (3.7 g, 9.6 mmols) in 4N HCl in dioxane (12 ml, 48.0 mmols) was stirred at room temperature for 2 h, then concentrated to dryness (water bath < 30°C). The residue was triturated with DCM/ether (1/10, 2x10 mL) and the white solid dried under high vacuum to provide the product (2.96 g, yield: 92%).1H NMR (300 MHz, DMSO-d6 ) 9.11 (s, 1H), 8.1 (bs, 3H), 7.63-7.60 (d, 1H), 6.92-6.89 (d, 1H), 5.27-5.24 (m, 1H), 4.12-4.05 (m, 2H) , 3.62-3.57 (m, 1H), 2.99-2.92 (m, 1H), 1.34-1.30 (t, 3H); MS (ESI) m/z = 287 [M + H]+. EXAMPLE 2 LeuRS IC50 Test
[00351] The experiments were performed in 96-well microliter plates, using 80 µL of reaction mixture containing 50 mM HEPES-KOH (pH 8.0), 30 mM MgCl2 and 30 mM KCI, [14C]leucine at 13μM (306 mCi/mmol, Perkin-Elmer), 13μM total E.coli tRNA (Roche, Switzerland), 0.02% (w/v) BSA, 1 mM DTT, 0.2 pM LeuRS and 4 mM ATP at 30°C. Reactions were initiated by the addition of 4 mM ATP. After 7 minutes, the reactions were quenched and tRNA was precipitated by adding 50 µL of 10% (w/v) TCA and transferred to 96-well nitrocellulose membrane filter plates (Millipore Multiscreen HTS, MSHAN4B50). Each well was then washed three times with 100 µL of 5% TCA. The filter plates were then dried under a heat lamp and precipitated [14C]leucine tRNALeu was quantified by liquid scintillation counting using a Wallac MicroBeta Trilux 1450 model liquid scintillation counter (PerkinElmer, Waltham MA).
[00352] To determine the concentration of inhibitor that reduces enzyme activity by 50% (IC50), increasing inhibitor concentrations were incubated with the enzyme LeuRS, tRNA and leucine for 20 minutes. Reactions were started by adding 4 mM ATP and stopped after 7 minutes, then precipitated and counted to quantify radioactivity.
[00353] The results of biochemical tests for exemplary compounds of the invention are provided in Figure 1. EXAMPLE 3 Antibacterial MIC Test
[00354] All bacterial MIC tests followed the Clinical and Laboratory Standards Institute (CLSI) guidelines for antimicrobial testing of aerobic bacteria (M07- A7) and anaerobic bacteria (Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria; Approved Standard - Seventh Edition) (M11-A7).
[00355] The results of antibacterial MIC tests for exemplary compounds of the invention are provided in Figure 1. EXAMPLE 4 Alamar Blue Microplate Assay (MABA)
The microplate alamar blue (MABA) assay was essentially performed as described by Collins, L., et al., Antimicrob Agents Chemother 41:1004-1009 (1997). For example, black, light-bottomed 96-well microplates (black display plates; with outer perimeter wells filled with sterile water to prevent dehydration in experimental wells. Initial drug dilutions were prepared in dimethyl sulfoxide dilutions and two-fold dilutions) Further times were performed in 0.1 ml of 7H9GC (without Tween 80) in the microplates. Frozen inocula were initially diluted 1:20 in BACTEC 12B medium followed by a 1:50 dilution in 7H9GC. The addition of 100 μL of wells resulted in final bacterial titers between 2.0x105 and 5x104 CFUmL for H37Rv and H37Ra, respectively. Wells containing drug only were used to detect autofluorescence of compounds plus additional control wells are composed of bacteria only (B) and medium only (M) Plates were incubated at 37°C. Beginning on day 4 of incubation, 20 µl of 10 x alamar Blue solution (Alamar BiosciencesAccumed, Westlake, Ohio) and 12.5 µl of 20% Tween 80 were added. to one well B and one well M, and the plates were reincubated at 37°C. Wells were observed at 12 and 24 h for a color to change from blue to pink and for a reading of greater than or equal to 50,000 fluorescence units (FU). Fluorescence was measured on excitation with a Cytofluor II microplate fluorimeter (PerSeptive Biosystems, Framingham, Mass.) in lower readout mode with 530 nm shake and 590 nm shake. If wells B turned pink for 24h, the reagent was added to the entire plate. If the well remained blue or 50,000 FU was measured, additional M and B wells were tested daily until a color change occurred, at which time reagents were added to all remaining wells. The plates were then incubated at 37°C, and results were recorded in post-reagent beyond 24h. Visual MICs were defined as the lowest drug concentration that prevented a color change. For fluorometric MICs, a background subtraction was performed on all wells with a medium of triplicate M wells. Percent inhibition was defined as 1-(test well FU half FU of triplicate B wells) x 100. The lowest drug concentration effecting 90% inhibition was considered the MIC.
[00357] The results of biochemical tests for exemplary compounds of the invention are provided in Figure 1. EXAMPLE 5 Low Oxygen Recovery Assay (LORA)
[00358] The low oxygen recovery test (LORA) was carried out essentially as described by Cho et al. Antimicrob Agents Chemother 51: 1380-1385 (2007). A recombinant M. tuberculosis H37Rv having luxAB on a plasmid, pFCA-luxAB, was used in all LORA experiments. Frozen aliquots of a low-oxygen adapted culture were thawed, diluted in Middlebrook 7H 12 broth (Middlebrook 7H 9 broth containing 1 mg/mL Casitone, 5.6 μg/mL palmitic acid, 5 mg/mL albumin bovine serum, and 4 μg/ml of filter-sterilized catalase), and sonicated for 15s. Cultures were diluted to obtain an A570 of 0.03 to 0.05 and 3,000 to 7,000 RLUs per 100 μL. This corresponds to 5 x 105 to 2 x 106 CFU/mL. Serial two-fold dilutions were prepared in a volume of 100 µL in black 96-well microtiter plates, and 100 µL of the cell suspension was added. By LORA, microplate cultures were placed under anaerobic conditions (oxygen concentration, less than 0.16%) using an Anoxomat WS-8080 model (MART Microbiology) and three cycles of evacuation and filling with a mixture of 10 H2, CO2 5, and 85 N2. An anaerobic indicator strip was placed inside the chamber to visually confirm the removal of oxygen. Plates were incubated at 37°C for 10 days and then transferred to a room gas incubator (air enriched by 5% CO2) for a 28-h “recovery”. On day 11 (after the 28-h aerobic recovery), 100 µL of culture was transferred to white 96-well microtiter plates for luminescence determination. A 10% solution of n-decanal aldehyde (Sigma) in ethanol was freshly diluted 10-fold in PBS, and 100 µL was added to each well with an autoinjector. Luminescence was measured on a Victor2 multi-marker reader (Perkin-Elmer Life Sciences) using a readout time of 1 s. The MIC was defined as the lowest drug concentration, achieving 90% growth inhibition compared to growth for drug-free controls.
[00359] The results of biochemical tests for exemplary compounds of the invention are provided in Figure 1. EXAMPLE 6 Tuberculosis In Vivo Efficacy Experiments
[00360] In vivo TB efficacy experiments were performed as described in Lenaerts et al. Antimicrob Agents Chemother 47: 783-785 (2003) with some modifications. C57BL6-Ifngtm1ts (GKO) mice free of specific pathogens highly susceptible to interferon gamma (Jackson Laboratories, Bar Harbor, Maine) were exposed to a low-dose aerosol infection with the M. tuberculosis Erdman strain in a Glas-inhaler system. Col as previously described in Kelly et al. Antimicrob Agents Chemother 40: 2809-2812 (1996). Each treatment group consists of five mice for each time point below. Treatment was started 10 days after infection. A control group of infected mice was sacrificed at the start of treatment. A second group of infected but untreated mice were sacrificed after cessation of treatment within 24 days. C and L were formulated in saline solution and E was formulated in 50% water/35% PEG400/5% PG, while rifampicin was formulated in 20% cyclodextrin. All compounds were administered by oral gavage. Rifampicin was dosed at 10 mg/kg QD PO. C was dosed at 100 mg/kg BID PO. And it was dosed at 100 mg/kg BID PO. L was dosed at 100 mg/kg QD PO. After completion of therapy, mice were sacrificed by carbon dioxide inhalation. Lungs were removed aseptically and interrupted in a tissue homogenizer. The number of viable organisms was determined by serial dilution of homogenates on Middlebrook 7H 11 nutrient agar plates (GIBCO BRL, Gaithersburg, Md.). Plates were incubated at 37°C in room air for 4 weeks before counting viable M. tuberculosis colonies (CFU).
On day 3, the control group had a mean log10 CFU/lung of 2.83 (0.40). On day 10, the control group had a log10 CFU/lung of 4.81 (0.08). On day 24, the control group had a log10 CFU/lung of 8.96 (0.14). On day 24, the rifampicin-treated group had a log10 CFU/lung of 6.16 (0.10). On day 24, the C-treated group had a log10 CFU/lung of 5.06 (0.26). On day 24, the E-treated group had a log10 CFU/lung of 2.73 (0.05). On day 24, the L-treated group had a log10 CFU/lung of 3.08 (0.06). EXAMPLE 7 Tuberculosis In Vivo Efficacy Experiments
In vivo TB efficacy experiments were performed essentially as described in Lenaerts et al. Antimicrob Agents Chemother 47: 783-785 (2003) with some modifications. C57BL6-Ifngtm1ts (GKO) mice free of specific pathogens highly susceptible to interferon gamma (Jackson Laboratories, Bar Harbor, Maine) were exposed to a low dose aerosol infection with M. tuberculosis Erdman strain in a Glas inhalation exposure system -Col as previously described in Kelly et al. Antimicrob Agents Chemother 40: 2809-2812 (1996). Each treatment group consists of five mice for each time point below. Treatment started 13 days after infection. A control group of infected mice was sacrificed at the start of treatment. A second group of infected but untreated mice were sacrificed after cessation of treatment at 22 days. N was formulated in saline and E was formulated in 50% water/35% PEG400/5% PG, while Isoniazid (INH) was formulated in distilled water. All compounds were administered by oral gavage. INH was measured at 25 mg/kg QD PO. And it was dosed at 100 mg/kg QD PO. It was not dosed at 100 mg/kg BID PO. After completion of therapy, mice were sacrificed by carbon dioxide inhalation. Spleens and lungs were removed aseptically and interrupted in a tissue homogenizer. The number of viable organisms was determined by serial dilution of homogenates on Middlebrook 7H 11 nutrient agar plates (GIBCO BRL, Gaithersburg, MD.). Plates were incubated in room air at 37°C for 4 weeks before counting viable M. tuberculosis colonies (CFU).
On day 13, the control group had a mean log10 CFU of 7.02 (0.08) for the lungs and a mean log10 CFU for the spleens of 3.99 (0.21). On day 22, the control group had a log10 CFU for lungs of 7.82 (0.11) and spleens of 6.69 (0.08). On day 22, the INH-treated group had a log10 CFU for lungs of 5.29 (0.13) and for spleens 4.27 (0.25). On day 22, the E-treated group had a log10 CFU for lungs of 5.27 (0.12) and for spleens 4.27 (0.25). On day 22, the N-treated group had a log10 CFU for lungs of 5.51 (0.09) and spleens of 2.42 (0.48).
[00364] It is understood that the examples and modalities described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and should be included in the spirit and competence of this application and the scope of the claims in attachment. All Publications, Patents, and Patent Applications cited in this document are hereby incorporated by reference in their entirety for all purposes.

权利要求:
Claims (41)
[0001]
1. Composite, characterized by the fact that it has a structure that is:
[0002]
2. Compound according to claim 1, characterized in that it has a structure that is:
[0003]
3. Compound according to claim 2, characterized in that the C* stereocenter is in the (S) configuration.
[0004]
4. Compound according to claim 1, characterized in that it comprises a structure that is:
[0005]
5. Compound according to claim 1, characterized in that it comprises a structure that is:
[0006]
6. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2.
[0007]
7. A compound according to any one of claims 1 to 5, characterized in that R4 is selected from the group consisting of fluorine, chlorine, bromine, and iodine.
[0008]
8. A compound according to any one of claims 1 to 5, characterized in that R5 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, and sec-butyl.
[0009]
9. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; and R4 is halogen.
[0010]
10. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; and R5 is methyl or ethyl.
[0011]
11. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; R4 is chlorine.
[0012]
12. Compound according to any one of claims 1 to 5, characterized in that R4 is bromine.
[0013]
13. Compound according to any one of claims 1 to 5, characterized in that R4 is chlorine.
[0014]
14. A compound according to any one of claims 1 to 5, characterized in that R4 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, and sec-butyl.
[0015]
15. Compound according to any one of claims 1 to 5, characterized in that R4 is methyl.
[0016]
16. A compound according to any one of claims 1 to 5, characterized in that R4 is selected from the group consisting of methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, and sec-butoxy.
[0017]
17. Compound according to any one of claims 1 to 5, characterized in that R4 is methoxy or ethoxy.
[0018]
18. Compound according to any one of claims 1 to 5, characterized in that R5 is unsubstituted alkyl.
[0019]
19. Compound according to any one of claims 1 to 5, characterized in that R4 is halogen, R3 is -CH2NH2; and R5 is methyl; or R4 is halogen, R3 is -CH2NH2; and R5 is ethyl; or R4 is halogen, R3 is -CH2NH2; and R5 is propyl; or R4 is halogen, R3 is -CH2NH2; and R5 is isopropyl; or R4 is halogen, R3 is -CH2NH2; and R5 is unsubstituted C4 alkyl; or R4 is halogen, R3 is -CH2NH2; and R5 is unsubstituted C5 alkyl; or R4 is halogen, R3 is -CH2NH2; and R5 is unsubstituted C6 alkyl.
[0020]
20. Compound according to any one of claims 1 to 5, characterized in that R4 is halogen, R3 is -CH2NH2; and R5 is methyl; or R4 is halogen, R3 is -CH2NH2; and R5 is ethyl; or R4 is halogen, R3 is -CH2NH2; and R5 is propyl.
[0021]
21. Compound according to any one of claims 1 to 5, characterized in that R4 is halogen, R3 is -CH2NH2; R5 is ethyl.
[0022]
22. Compound according to any one of claims 1 to 5, characterized in that R4 is fluorine, R3 is -CH2NH2; and R5 is methyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is methyl; or R4 is bromo, R3 is -CH2NH2; and R5 is methyl; or R4 is fluorine, R3 is -CH2NH2; and R5 is ethyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is ethyl; or R4 is bromo, R3 is -CH2NH2; and R5 is ethyl; or R4 is fluorine, R3 is -CH2NH2; and R5 is propyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is propyl; or R4 is bromo, R3 is -CH2NH2; and R5 is propyl; or R4 is fluorine, R3 is -CH2NH2; and R5 is isopropyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is isopropyl; or R4 is bromo, R3 is -CH2NH2; and R5 is isopropyl; or R4 is fluorine, R3 is -CH2NH2; and R5 is unsubstituted C4 alkyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is unsubstituted C4 alkyl; or R4 is bromo, R3 is -CH2NH2; and R5 is unsubstituted C4 alkyl; R4 is fluorine, R3 is -CH2NH2; and R5 is unsubstituted C5 alkyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is unsubstituted C5 alkyl; or R4 is bromo, R3 is -CH2NH2; and R5 is unsubstituted C5 alkyl; or R4 is fluorine, R3 is -CH2NH2; and R5 is unsubstituted C6 alkyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is unsubstituted C6 alkyl; or R4 is bromo, R3 is -CH2NH2; and R5 is unsubstituted C6 alkyl.
[0023]
23. Compound according to any one of claims 1 to 5, characterized in that R4 is fluorine, R3 is -CH2NH2; and R5 is ethyl; or R4 is chlorine, R3 is -CH2NH2; and R5 is ethyl; or R4 is bromo, R3 is -CH2NH2; and R5 is ethyl.
[0024]
24. Compound according to any one of claims 1 to 5, characterized in that R4 is chlorine, R3 is -CH2NH2; and R5 is ethyl.
[0025]
25. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; R4 is chlorine; and R5 is methyl.
[0026]
26. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; R4 is bromine; and R5 is methyl.
[0027]
27. Compound according to any one of claims 1 to 5, characterized in that R3 is -CH2NH2; R4 is bromine; and R5 is ethyl.
[0028]
28. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that a is 1, 2, 3, 4 or 5.
[0029]
29. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that a is 2, 3 or 4.
[0030]
30. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that a is 3.
[0031]
31. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that each R10 and each R11 is H.
[0032]
32. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that R12 is OH.
[0033]
33. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that R3 is -CH2NH2; and R4 is chlorine.
[0034]
34. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that R3 is -CH2NH2; and R4 is bromo.
[0035]
35. A compound according to any one of claims 1 to 5, or a salt, hydrate or solvate thereof, characterized in that R3 is -CH2NH2; and R4 is methyl.
[0036]
36. Pharmaceutical composition for the treatment or prophylaxis of bacterial infection or tuberculosis, characterized in that it comprises: a) a first stereoisomer of the compound, as defined in claim 2; b) at least one additional stereoisomer of the first stereoisomer; wherein the first stereoisomer is present in an enantiomeric excess of at least 80% with respect to said at least one additional stereoisomer.
[0037]
37. Combination for the treatment or prophylaxis of bacterial infection or tuberculosis, characterized in that it comprises the compound as defined in claim 1, or a pharmaceutically acceptable salt thereof, together with at least one other therapeutically active agent.
[0038]
38. Pharmaceutical formulation for the treatment or prophylaxis of bacterial infection or tuberculosis, characterized in that it comprises: a) a compound, as defined in claim 1, or a pharmaceutically acceptable salt thereof; and b) a pharmaceutically acceptable excipient.
[0039]
39. Pharmaceutical formulation according to claim 38, characterized in that the bacterial infection involves a bacterium of the genus Mycobacterium.
[0040]
40. Pharmaceutical formulation according to claim 38, characterized in that the bacterial infection involves Mycobacterium tuberculosis.
[0041]
41. Pharmaceutical formulation for the treatment or prophylaxis of bacterial infection or tuberculosis, characterized in that it comprises: a) a combination as defined in claim 37, or a pharmaceutically acceptable salt thereof; and b) a pharmaceutically acceptable excipient.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013005426B1|2021-08-24|COMPOUND, COMPOSITION, COMBINATION, AND, PHARMACEUTICAL FORMULATION

---

US8461134B2|2013-06-11|Boron-containing small molecules

---

US20100256092A1|2010-10-07|Boron-containing small molecules

---

US20110124597A1|2011-05-26|Boron containing small molecules

---

NZ582706A|2012-07-27|1-Hydroxy-1,3-dihydro-benzo[c][1,2]oxaboroles and their derivatives

---

US10919916B2|2021-02-16|Boron-containing small molecules

---

CN114007605A|2022-02-01|Macrocyclic broad spectrum antibiotics

同族专利:

---

公开号 | 公开日

---

PT3251678T|2021-11-22|

---

DK2613788T3|2017-08-07|

---

EA028743B1|2017-12-29|

---

PL3251678T3|2022-01-10|

---

KR20140093598A|2014-07-28|

---

BR112013005426A2|2016-06-07|

---

LT3251678T|2021-12-10|

---

US20120115813A1|2012-05-10|

---

EP3251678A1|2017-12-06|

---

JP2019112431A|2019-07-11|

---

KR101949423B1|2019-02-18|

---

HK1247841A1|2018-10-05|

---

IL225000A|2016-03-31|

---

JP2018058836A|2018-04-12|

---

JP2016199558A|2016-12-01|

---

ES2635333T3|2017-10-03|

---

EA201390274A1|2013-08-30|

---

MX2013002651A|2013-04-19|

---

ZA201301598B|2021-08-25|

---

US11008345B2|2021-05-18|

---

KR102152901B1|2020-09-07|

---

WO2012033858A3|2012-05-10|

---

SG187969A1|2013-04-30|

---

AU2011299243C1|2016-06-02|

---

EA201791850A1|2018-01-31|

---

KR20190018549A|2019-02-22|

---

HRP20211762T1|2022-02-18|

---

WO2012033858A2|2012-03-15|

---

JP6491294B2|2019-03-27|

---

CA2810021C|2018-05-29|

---

DK3251678T3|2021-11-22|

---

SI3251678T1|2022-01-31|

---

EP2613788B1|2017-06-21|

---

US20190345173A1|2019-11-14|

---

MX338209B|2016-04-07|

---

SG10201507032YA|2015-10-29|

---

EP3251678B1|2021-10-20|

---

CN103140228A|2013-06-05|

---

JP2013541514A|2013-11-14|

---

JP5952280B2|2016-07-13|

---

CN108610356A|2018-10-02|

---

EP2613788A2|2013-07-17|

---

US20140315860A1|2014-10-23|

---

US9751898B2|2017-09-05|

---

US8703742B2|2014-04-22|

---

EA033311B1|2019-09-30|

---

AU2011299243B2|2015-09-17|

---

AU2011299243A1|2013-03-28|

---

CA2810021A1|2012-03-15|

---

CN108610356B|2021-02-26|

---

IL244556D0|2016-04-21|

---

IL244556A|2020-07-30|

---

US20170355719A1|2017-12-14|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2260336A|1939-10-16|1941-10-28|Dow Chemical Co|Method of preparation of organic borates|

---

US3686398A|1970-07-20|1972-08-22|Chevron Res|10,9-boroxarophenanthrene as fungicides|

---

GB1396904A|1972-08-11|1975-06-11|Ici Ltd|Method for the control of micro-organisms|

---

US4766113A|1975-10-24|1988-08-23|Chapman Chemical Company|Antimicrobial compositions and methods of using same|

---

US4602011A|1975-10-24|1986-07-22|Chapman Chemical Company|Antimicrobial compositions and methods of using same|

---

US4716035A|1985-05-24|1987-12-29|The Procter & Gamble Company|Oral compositions and methods for treating gingivitis|

---

US5962498A|1986-06-11|1999-10-05|Procyon Pharmaceuticals, Inc.|Protein kinase C modulators. C. indolactam structural-types with anti-inflammatory activity|

---

US4894220A|1987-01-30|1990-01-16|Colgate-Palmolive Company|Antibacterial antiplaque oral composition|

---

US4919934A|1989-03-02|1990-04-24|Richardson-Vicks Inc.|Cosmetic sticks|

---

US5274792A|1989-08-19|1993-12-28|Fujitsu Limited|Information processing apparatus with parallel instruction decoding|

---

SG47101A1|1992-07-31|1998-03-20|Us Bioscience|Crystalline amifostine compositions and methods for the preparation and use of same|

---

US5348948A|1993-05-07|1994-09-20|American Cyanamid Company|2,2-diaryl-1--2a-azonia-2-borataacenaphthene fungicidal|

---

US5348947A|1993-05-07|1994-09-20|American Cyanamid Company|Diarylboron ester and thioester fungicidal agents|

---

US5594151A|1994-01-28|1997-01-14|Prolinx, Inc.|Phenylboronic acid complexing reagents derived from aminosalicylic acid|

---

GB9411587D0|1994-06-09|1994-08-03|Zeneca Ltd|Compound, composition and use|

---

US6083903A|1994-10-28|2000-07-04|Leukosite, Inc.|Boronic ester and acid compounds, synthesis and uses|

---

GB9500856D0|1995-01-17|1995-03-08|Zeneca Ltd|Composition and use|

---

GB9604926D0|1996-03-08|1996-05-08|Sandoz Ltd|Organic compounds|

---

AU3102697A|1996-06-19|1998-01-07|Rhone-Poulenc Rorer Limited|Substituted azabicylic compounds and their use as inhibitors of the production of tnf and cyclic amp phosphodiesterase|

---

US5831046A|1996-08-05|1998-11-03|Prolinx, Incorporated|Boronic acid-contaning nucleic acid monomers|

---

WO1998012206A1|1996-09-19|1998-03-26|The Board Of Trustees Of Leland Stanford Jr. University|Dna adenine methyltransferases and uses thereof|

---

DE69730737D1|1996-12-02|2004-10-21|Chisso Corp|OPTICALLY ACTIVE NITRO ALCOHOL DERIVATIVES, OPTICALLY ACTIVE AMINO ALCOHOL DERIVATIVES AND METHOD FOR THE PRODUCTION THEREOF|

---

US6221640B1|1997-05-14|2001-04-24|Cubist Pharmaceuticals, Inc.|Enterococcal aminoacyl-trna synthetase proteins, nucleic acids and strains comprising same|

---

DE19829947A1|1998-07-04|2000-01-05|Bayer Ag|Electroluminescent devices with boron chelates|

---

CA2350235A1|1998-11-06|2000-05-18|Basf Aktiengesellschaft|Tricyclic pyrazole derivatives|

---

US6462036B1|1998-11-06|2002-10-08|Basf Aktiengesellschaft|Tricyclic pyrazole derivatives|

---

WO2000044387A1|1999-01-29|2000-08-03|Nitto Kasei Co., Ltd.|Organoboron compounds exhibiting anticoccidial activities|

---

WO2001049302A1|2000-01-06|2001-07-12|Marantech Holding, Llc|Compositions and methods for facilitating skin growth and managing skin conditions|

---

WO2000075142A2|1999-05-25|2000-12-14|The Penn State Research Foundation|Dna methyltransferase inhibitors|

---

US6306628B1|1999-08-25|2001-10-23|Ambergen, Incorporated|Methods for the detection, analysis and isolation of Nascent proteins|

---

AT349548T|1999-08-25|2007-01-15|Ambergen Inc|METHOD FOR THE DETECTION, ANALYSIS AND ISOLATION OF RELEASED PROTEINS|

---

AU7995300A|1999-10-05|2001-05-10|Bethesda Pharmaceuticals, Inc.|Dithiolane derivatives|

---

US6521619B2|2000-06-29|2003-02-18|Icos Corporation|Aryl phenylcyclopropyl sulfide derivatives and their use as cell adhesion inhibiting anti-inflammatory and immune suppressive agents|

---

US7169603B2|2000-07-14|2007-01-30|Mgi Pharma Biologics, Inc.|α-MSH related compounds and methods of use|

---

AT346074T|2000-11-30|2006-12-15|Penn State Res Found|DNA METHYL TRANSFERASE INHIBITORS|

---

DE10110051C2|2001-03-02|2003-07-03|Clariant Gmbh|Process for the preparation of boronic and boric acids|

---

EP1392262A1|2001-05-24|2004-03-03|Alexza Molecular Delivery Corporation|Delivery of drug esters through an inhalation route|

---

US20030051728A1|2001-06-05|2003-03-20|Lloyd Peter M.|Method and device for delivering a physiologically active compound|

---

GB0117645D0|2001-07-19|2001-09-12|Isis Innovation|Therapeutic stratergies for prevention and treatment of alzheimers disease|

---

DE10143979A1|2001-09-07|2003-03-27|Clariant Gmbh|Process for the preparation of bisallylboranes and non-aromatic boronic acids|

---

WO2003033002A1|2001-10-11|2003-04-24|Ono Pharmaceutical Co|Intracellular calcium concentration increase inhibitors|

---

CA2473238A1|2002-01-10|2003-07-24|The Penn State Research Foundation|Methods for the preparation of alkyl diaryl borinates and complexed diarylboronic acids|

---

WO2004004658A2|2002-07-09|2004-01-15|Point Therapeutics, Inc.|Methods and compositions relating to isoleucine boroproline compounds|

---

JP2006508161A|2002-12-02|2006-03-09|ソルヴィーアス　アクチェンゲゼルシャフト|Catalytic hydrogenation of carbon-heteroatom double bonds|

---

US20040224923A1|2002-12-18|2004-11-11|Ving Lee|Antibiotics containing borinic acid complexes and methods of use|

---

US7390806B2|2002-12-18|2008-06-24|Anacor Pharmaceuticals, Inc.|Antibiotics containing borinic acid complexes and methods of use|

---

US20050125852A1|2003-05-09|2005-06-09|Sugen, Inc.|Novel kinases|

---

BRPI0411582A|2003-06-16|2006-08-08|Anacor Pharmaceuticals Inc|hydrolytically resistant boron-containing therapeutic substances and method of use|

---

PT1755661E|2004-05-12|2014-06-03|Brigham & Womens Hospital|Gelsolin for use in treating infections|

---

AR049915A1|2004-06-14|2006-09-13|Anacor Pharmaceuticals Inc|COMPOUNDS WITH BORO CONTENT AND METHODS OF USE OF THE SAME|

---

WO2006062731A1|2004-11-19|2006-06-15|University Of North Texas Health Science Center At Fort Worth|Phenanthroline and derivatives thereof used to lower intraocular pressure in an affected eye|

---

GB0501944D0|2005-01-31|2005-03-09|Univ Cambridge Tech|Compounds for use in chemical detection and/or quantitation|

---

DK3424932T3|2005-02-16|2021-05-25|Anacor Pharmaceuticals Inc|Bronophthalides for therapeutic use|

---

KR20080110984A|2005-12-30|2008-12-22|아나코르 파마슈티칼스 인코포레이티드|Boron-containing small molecules|

---

US7919422B2|2005-03-08|2011-04-05|Agency For Science, Technology And Research|Chiral bisoxazoline catalysts|

---

US20060251689A1|2005-03-30|2006-11-09|Astion Development A/S|Treatment or prevention of pruritus|

---

WO2007022437A2|2005-08-18|2007-02-22|Auspex Pharmaceuticals, Inc.|Therapeutic agents for the treatment of cancer and metabolic disorders|

---

CA2933994A1|2006-02-16|2007-08-23|Anacor Pharmaceuticals, Inc.|Boron-containing small molecules as anti-inflammatory agents|

---

JP2009536660A|2006-05-02|2009-10-15|アナコールファーマシューティカルズ，インコーポレイテッド|Hydrolysis-resistant boron-containing therapeutic agent and method of use thereof|

---

US20070286822A1|2006-06-12|2007-12-13|Anacor Pharmaceuticals Inc.|Compounds for the Treatment of Periodontal Disease|

---

CA2654449A1|2006-06-12|2007-12-21|Anacor Pharmaceuticals, Inc.|Compounds for the treatment of periodontal disease|

---

KR100848491B1|2007-01-16|2008-07-28|영진약품공업주식회사|2-thiazolidine derivatives having beta;-amino group, pharmaceutical acceptable salts and preparation process thereof|

---

JO3396B1|2007-06-20|2019-10-20|Anacor Pharmaceuticals Inc|Boron-containing small molecules|

---

EP2187893A4|2008-03-06|2012-02-22|Anacor Pharmaceuticals Inc|Boron-containing small molecules as anti-inflammatory agents|

---

AU2009221793B2|2008-03-06|2015-02-19|Anacor Pharmaceuticals, Inc|Boron-containing small molecules as anti-inflammatory agents|

---

EP2285384A4|2008-05-12|2012-04-25|Anacor Pharmaceuticals Inc|Boron-containing small molecules|

---

WO2010028005A1|2008-09-04|2010-03-11|Anacor Pharmaceuticals, Inc.|Boron-containing small molecules|

---

WO2010045505A1|2008-10-15|2010-04-22|Anacor Pharmaceuticals, Inc|Boron-containing small molecules as anti-protozoal agents|

---

WO2010045503A1|2008-10-15|2010-04-22|Anacor Pharmaceuticals, Inc.|Boron-containing small molecules as anti-protozoal agents|

---

BRPI0922566A2|2008-12-17|2017-03-28|Anacor Pharmaceuticals Inc|crystalline polymorph, pharmaceutical composition, compound, and methods for preparing a compound, and for treating a disease.|

---

KR20130031233A|2009-07-28|2013-03-28|아나코르 파마슈티칼스 인코포레이티드|Trisubstituted boron-containing molecules|

---

EA028743B1|2010-09-07|2017-12-29|Анакор Фармасьютикалс, Инк.|Benzoxaborole derivatives as antibacterial agents|KR20080110984A|2005-12-30|2008-12-22|아나코르 파마슈티칼스 인코포레이티드|Boron-containing small molecules|

---

AP4039A|2009-08-14|2017-02-28|Daitao Chen|Boron-containing small molecules as antiprotozoal agents|

---

US8716478B2|2010-01-27|2014-05-06|Anacor Pharmaceuticals, Inc.|Boron-containing small molecules|

---

EA028743B1|2010-09-07|2017-12-29|Анакор Фармасьютикалс, Инк.|Benzoxaborole derivatives as antibacterial agents|

---

CA2858799A1|2011-12-22|2013-06-27|Micurx Pharmaceuticals, Inc.|Tricyclic boron compounds for antimicrobial therapy|

---

RU2595157C1|2013-01-30|2016-08-20|Агрофреш Инк.|Use of benzoxaboroles as antimicrobial agents for treatment of meat products, plants or parts of plants|

---

US9585396B2|2013-01-30|2017-03-07|Agrofresh Inc.|Volatile applications against pathogens|

---

US8669207B1|2013-01-30|2014-03-11|Dow Agrosciences, Llc.|Compounds and compositions|

---

US10070649B2|2013-01-30|2018-09-11|Agrofresh Inc.|Volatile applications against pathogens|

---

US11039617B2|2013-01-30|2021-06-22|Agrofresh Inc.|Large scale methods of uniformly coating packaging surfaces with a volatile antimicrobial to preserve food freshness|

---

AP2015008638A0|2013-02-01|2015-08-31|Anacor Pharmaceuticals Inc|Boron-containing small molecules as antiprotozoal agents|

---

KR101636431B1|2013-07-30|2016-07-05|동아에스티 주식회사|Tricyclic benzoxaborole compound, process preparing thereof and use thereof|

---

SG11201600787PA|2013-08-09|2016-03-30|Glaxosmithkline Ip No 2 Ltd|Tricyclic benzoxaborole compounds and uses thereof|

---

EA038093B1|2013-12-20|2021-07-05|Глаксосмитклайн Интеллекчуал ПропертиЛимитед|METHOD OF TREATING A DISEASE CAUSED BY A MYCOBACTERIUM TUBERCULOSIS COMPLEX INFECTION USING -METHANAMINE OR A PHARMACEUTICALLY ACCEPTABLE SALT THEREOF|

---

ES2732465T3|2014-07-01|2019-11-22|Daiichi Sankyo Co Ltd|Tricyclic benzoxaboroles as antibacterial agents|

---

MA41495A|2015-02-12|2017-12-19|Anacor Pharmaceuticals Inc|BENZOXABOROLE COMPOUNDS AND THEIR USES|

---

EP3426029A4|2016-03-07|2019-11-13|AgroFresh Inc.|Synergistic methods of using benzoxaborole compounds and preservative gases as an antimicrobial for crops|

---

EP3609504A4|2017-03-01|2021-03-03|Anacor Pharmaceuticals, Inc.|Novel oxaborole analogs and uses thereof|

---

CN108727176B|2018-07-26|2021-05-18|荆楚理工学院|Method for preparing 5-halogen-2, 3-dihydroxy benzaldehyde|

---

BR112021003037A2|2018-08-18|2021-05-11|Boragen, Inc.|solid forms of substituted benzoxaborol and compositions thereof|

---

WO2021021932A1|2019-07-30|2021-02-04|Boragen, Inc.|Flow reaction process for manufacture of boron-containing agrochemicals|

---

CN110664756B|2019-10-09|2020-11-17|吉林大学|Trauma spray for children and preparation method thereof|

---

WO2022043936A1|2020-08-31|2022-03-03|Pfizer Inc.|Methods of protecting rna|

法律状态:
2018-01-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-02| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-09-03| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-04-06| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-07-13| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-08-24| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 07/09/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US38059610P| true| 2010-09-07|2010-09-07|

---

US61/380,596|2010-09-07|

---

PCT/US2011/050728|WO2012033858A2|2010-09-07|2011-09-07|Boron-containing small molecules|

---